CRISPR

CRISPR2-tardbpa

ID
ZDB-CRISPR-190604-4
Name
CRISPR2-tardbpa
Previous Names
  • CRISPR2-tardbpl
Target
Sequence
5' - CGCATTCGGTGTAATCATGACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
udm104 tardbpa
Expression
Gene expression in Wild Types + CRISPR2-tardbpa
No data available
Phenotype
Phenotype resulting from CRISPR2-tardbpa
No data available
Phenotype of all Fish created by or utilizing CRISPR2-tardbpa
Phenotype Fish Conditions Figures
myotome neuromuscular junction development decreased occurrence, abnormal tardbpaudm104/udm104 standard conditions Fig. 5 with image from Bose et al., 2018
fast muscle cell neuromuscular synaptic transmission process quality, ameliorated tardbpbfh301/+; tardbpaudm104/udm104 chemical treatment by environment: Bay-K-8644 Fig. 6 with image from Bose et al., 2018
swimming occurrence, ameliorated tardbpbfh301/+; tardbpaudm104/udm104 chemical treatment by environment: Bay-K-8644 Fig. 6 with image from Bose et al., 2018
fast muscle cell mini excitatory postsynaptic potential decreased frequency, abnormal tardbpbfh301/+; tardbpaudm104/udm104 standard conditions Fig. 4 with imageFig. 6 with image from Bose et al., 2018
heart edematous, abnormal tardbpbfh301/+; tardbpaudm104/udm104 standard conditions Fig. 2 with image from Bose et al., 2018
fast muscle cell neuromuscular synaptic transmission decreased process quality, abnormal tardbpbfh301/+; tardbpaudm104/udm104 standard conditions Fig. 4 with imageFig. 6 with image from Bose et al., 2018
swimming decreased occurrence, abnormal tardbpbfh301/+; tardbpaudm104/udm104 standard conditions Fig. 3 with imageFig. 6 with image from Bose et al., 2018
myotome neuromuscular junction development decreased occurrence, exacerbated tardbpbfh301/+; tardbpaudm104/udm104 standard conditions Fig. 5 with image from Bose et al., 2018
fast muscle cell mini excitatory postsynaptic potential frequency, ameliorated tardbpbfh301/+; tardbpaudm104/udm104 chemical treatment by environment: Bay-K-8644 Fig. 6 with image from Bose et al., 2018
whole organism decreased life span, abnormal tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 2 with image from Bose et al., 2018
musculoskeletal movement decreased occurrence, abnormal tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 3 with image from Bose et al., 2018
swimming decreased occurrence, exacerbated tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 3 with image from Bose et al., 2018
fast muscle cell mini excitatory postsynaptic potential decreased frequency, exacerbated tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 4 with image from Bose et al., 2018
heart edematous, abnormal tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 2 with image from Bose et al., 2018
swimming normal occurrence, ameliorated tardbpbfh301/fh301; tardbpaudm104/udm104 chemical treatment by environment: chemical substance Fig. 3 from Bose et al., 2019
swimming decreased occurrence, abnormal tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 3 from Bose et al., 2019
fast muscle cell neuromuscular synaptic transmission decreased process quality, exacerbated tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 4 with image from Bose et al., 2018
whole organism dead, abnormal tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 2 with image from Bose et al., 2018
myotome neuromuscular junction development decreased occurrence, exacerbated tardbpbfh301/fh301; tardbpaudm104/udm104 standard conditions Fig. 5 with image from Bose et al., 2018
Citations