CRISPR

CRISPR3-yap1

ID

ZDB-CRISPR-180608-2

Name

CRISPR3-yap1

Previous Names

None

Target

yap1 (1)

Sequence

5' - ACCTCATCGGCACGGAAGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
bns19	yap1
bns22	yap1

Expression

Gene expression in Wild Types + CRISPR3-yap1

No data available

Phenotype

Phenotype resulting from CRISPR3-yap1

No data available

Phenotype of all Fish created by or utilizing CRISPR3-yap1

Phenotype	Fish	Conditions	Figures
notochord yap1 expression absent, abnormal	yap1^bns19/bns19	control	Fig. 2 from Kimelman et al., 2017
ectoderm yap1 expression absent, abnormal	yap1^bns19/bns19	control	Fig. 2 from Kimelman et al., 2017
dorsal longitudinal vein truncated, abnormal	yap1^bns19/bns19; ci1Tg	control	Fig. S8 from Astone et al., 2018
mesencephalic vein truncated, abnormal	yap1^bns19/bns19; ci1Tg	control	Fig. S8 from Astone et al., 2018
hyaloid vessel decreased amount, abnormal	yap1^bns19/bns19; ci1Tg	control	Fig. S8 from Astone et al., 2018
dorsal aorta mrc1a expression mislocalised, abnormal	yap1^bns19/bns19; wwtr1^bns35/+	control	Fig. 5 from Astone et al., 2018
caudal fin curved, abnormal	yap1^bns19/bns19; wwtr1^bns35/+	standard conditions	Fig. 5 from Astone et al., 2018
notochord undulate, abnormal	yap1^bns19/bns19; wwtr1^bns35/+	standard conditions	Fig. 5 from Astone et al., 2018
posterior caudal vein split, abnormal	yap1^bns19/bns19; wwtr1^bns35/+; ci1Tg; nz101Tg	standard conditions	Fig. 5 from Astone et al., 2018
posterior caudal vein spatial deviation, abnormal	yap1^bns19/bns19; wwtr1^bns35/+; ci1Tg; nz101Tg	standard conditions	Fig. 5 from Astone et al., 2018
posterior caudal vein morphology, abnormal	yap1^bns19/bns19; wwtr1^bns35/+; ci1Tg; nz101Tg	standard conditions	Fig. 5 from Astone et al., 2018
epidermis morphogenesis process quality, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 6 from Kimelman et al., 2017
ectoderm separated from somite, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 11 from Kimelman et al., 2017
ectoderm anatomical region ab2-fn labeling spatial pattern, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 9 from Kimelman et al., 2017
ventral fin fold epidermal cell increased speed, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 8 from Kimelman et al., 2017
notochord posterior region ab2-fn labeling decreased amount, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 9 from Kimelman et al., 2017
pericardium edematous, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Kimelman et al., 2017
ectoderm decreased thickness, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 5 , Fig. 6 from Kimelman et al., 2017
whole organism posterior region morphology, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Kimelman et al., 2017
somite shape, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Kimelman et al., 2017
ectoderm ecrg4b expression absent, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 3 from Kimelman et al., 2017
notochord undulate, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 1 , Fig. 9 from Kimelman et al., 2017
notochord posterior region wu:fc23c09 expression absent, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 3-S1 from Kimelman et al., 2017
ventral fin fold epidermis morphogenesis process quality, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 7 from Kimelman et al., 2017
ventral fin fold epidermal cell shape, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 8 from Kimelman et al., 2017
epidermal basal stratum chromosome damaged, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 4 from Lai et al., 2022
ectoderm ab1-tp63 labeling decreased amount, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Lai et al., 2022
epidermal basal stratum cell apoptotic, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 1 , Fig. 4 from Lai et al., 2022
epidermal basal stratum cell decreased size, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 5 from Lai et al., 2022

Citations