CRISPR

CRISPR1-prmt5

ID

ZDB-CRISPR-180319-4

Name

CRISPR1-prmt5

Previous Names

None

Target

prmt5 (1)

Sequence

5' - CTTTGATTTCCTGTGTATGCCGCTGTTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ihb1994	prmt5
ihb1995	prmt5

Expression

Gene expression in Wild Types + CRISPR1-prmt5

No data available

Phenotype

Phenotype resulting from CRISPR1-prmt5

No data available

Phenotype of all Fish created by or utilizing CRISPR1-prmt5

Phenotype	Fish	Conditions	Figures
whole organism viability, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 1 from Zhu et al., 2019
spermatogonium absent, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 2 from Zhu et al., 2019
female organism ratio male organism, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 1 , Fig. S3 from Zhu et al., 2019
testis peptidyl-arginine methylation, to symmetrical-dimethyl arginine disrupted, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 from Zhu et al., 2019
testis apoptotic chromosome condensation increased occurrence, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 from Zhu et al., 2019
spermatid absent, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 2 , Fig. 8 from Zhu et al., 2019
testis atrophied, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 1 , Fig. S3 from Zhu et al., 2019
primordial germ cell decreased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 3 from Zhu et al., 2019
testis histone arginine N-methyltransferase activity disrupted, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 from Zhu et al., 2019
ovarian follicle atresia increased occurrence, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 2 from Zhu et al., 2019
gonad apoptotic, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 4 from Zhu et al., 2019
primordial germ cell ddx4 expression mislocalised, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 3 from Zhu et al., 2019
spermatogenic cyst absent, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 2 from Zhu et al., 2019
gonad ddx4 expression decreased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 3 from Zhu et al., 2019
immature gonad apoptotic chromosome condensation increased occurrence, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 2 from Zhu et al., 2019
Sertoli cell increased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 from Zhu et al., 2019
seminiferous tubule increased size, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 from Zhu et al., 2019
spermatogonium absence due to degeneration, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 from Zhu et al., 2019
testis Ab1-sDMA labeling absent, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 7 , text only from Zhu et al., 2019
testis piwil1 expression decreased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	text only from Zhu et al., 2019
male organism decreased fecundity, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 1 from Zhu et al., 2019
Sertoli cell present, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 2 from Zhu et al., 2019
sex determination disrupted, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. S3 from Zhu et al., 2019
germ cell migration disrupted, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 3 from Zhu et al., 2019
female organism absent, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 1 , Fig. S3 from Zhu et al., 2019
female sex differentiation disrupted, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 1 , Fig. S3 from Zhu et al., 2019
testis ddx4 expression decreased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	text only from Zhu et al., 2019
spermatocyte absent, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 2 from Zhu et al., 2019
primordial germ cell ddx4 expression decreased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 3 from Zhu et al., 2019
testis histone H4R3 methyltransferase activity disrupted, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 from Zhu et al., 2019
testis prmt5 expression absent, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 7 , text only from Zhu et al., 2019
peptidyl-arginine methylation disrupted, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	text only from Zhu et al., 2019
testis piwil2 expression decreased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	text only from Zhu et al., 2019
gonad sycp3 expression decreased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 3 from Zhu et al., 2019
Leydig cell increased amount, abnormal	prmt5^{ihb1994/ihb1994} (AB)	standard conditions	Fig. 8 , Fig. S3 from Zhu et al., 2019
testis piwil1 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
gonad cyp19a1a expression increased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
testis ddx4 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
gonad dnd1 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	Fig. S3 , text only from Zhu et al., 2019
gonad cyp11c1 expression increased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
gonad amh expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	Fig. S3 , text only from Zhu et al., 2019
testis sycp3 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
gonad cyp19a1a expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	Fig. S3 , text only from Zhu et al., 2019
gonad sycp3 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	Fig. S3 , text only from Zhu et al., 2019
testis dnd1 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
gonad amh expression increased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
testis cyp19a1a expression increased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
testis amh expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
gonad cyp11c1 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	Fig. S3 , text only from Zhu et al., 2019
gonad piwil1 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	Fig. S3 , text only from Zhu et al., 2019
testis sox9a expression increased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	text only from Zhu et al., 2019
gonad ddx4 expression decreased amount, abnormal	prmt5^ihb1994/+; prmt5^ihb1995/+ (AB)	standard conditions	Fig. S3 , text only from Zhu et al., 2019

Citations