CRISPR

CRISPR1-ltv1

ID

ZDB-CRISPR-180213-401

Name

CRISPR1-ltv1

Previous Names

None

Target

ltv1 (1)

Sequence

5' - GGACAGTGCTCGGCTGGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
swu54	ltv1
swu55	ltv1
zko1071a	ltv1
zko1071b	ltv1

Expression

Gene expression in Wild Types + CRISPR1-ltv1

No data available

Phenotype

Phenotype resulting from CRISPR1-ltv1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ltv1

Phenotype	Fish	Conditions	Figures
pancreatic acinar cell prss1 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
pancreatic B cell foxa3 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
pancreatic B cell ins expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
head kidney hematopoietic multipotent progenitor cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
Meckel's cartilage decreased size, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
pancreatic bud decreased area, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
thymus hematopoietic stem cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
erythroid progenitor cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
lymphocyte decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
nucleate erythrocyte decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
caudal hematopoietic tissue ikzf1 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
head tp53 expression increased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 7 from Zhang et al., 2021
intestine structure, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
neutrophil decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
head kidney hematopoietic stem cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
pericardium edematous, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
hepatocyte fabp10a expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
liver foxa3 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
liver decreased area, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
yolk increased size, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
enterocyte fabp2 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
palatoquadrate cartilage curled, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
whole organism dead, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	text only from Zhang et al., 2021
intestine lumen decreased width, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
head kidney myb expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
thymus myb expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
intestinal bulb enteroendocrine cell ab-2f11 labeling decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
ceratobranchial cartilage absence of anatomical entity, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
macrophage decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
head decreased size, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
caudal hematopoietic tissue myb expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
whole organism rRNA processing decreased process quality, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 6 from Zhang et al., 2021
thymus ikzf1 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
caudal hematopoietic tissue hematopoietic stem cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
gut foxa3 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
liver ltv1 expression decreased distribution, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
intestine goblet cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
swim bladder uninflated, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
intestinal bulb enteroendocrine cell decreased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 2 from Zhang et al., 2021
whole organism cdkn1a expression increased amount, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 7 from Zhang et al., 2021
ceratohyal cartilage absence of anatomical entity, abnormal	ltv1^swu54/swu54 (TU)	standard conditions	FIGURE 1 from Zhang et al., 2021
hematopoietic stem cell cell population proliferation decreased process quality, abnormal	ltv1^swu54/swu54; ioz1Tg (TU)	standard conditions	FIGURE 4 from Zhang et al., 2021
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal	ltv1^swu54/swu54; ioz1Tg (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
caudal hematopoietic tissue cell population proliferation decreased process quality, abnormal	ltv1^swu54/swu54; ioz1Tg (TU)	standard conditions	FIGURE 4 from Zhang et al., 2021
caudal hematopoietic tissue hematopoietic stem cell decreased amount, abnormal	ltv1^swu54/swu54; ioz1Tg (TU)	standard conditions	FIGURE 3 from Zhang et al., 2021
hematopoietic multipotent progenitor cell cell population proliferation decreased process quality, abnormal	ltv1^swu54/swu54; ioz1Tg (TU)	standard conditions	FIGURE 4 from Zhang et al., 2021
exocrine pancreas cell population proliferation decreased process quality, abnormal	ltv1^swu54/swu54; jh1Tg (TU)	standard conditions	FIGURE 4 from Zhang et al., 2021
whole organism cdkn1a expression amount, ameliorated	ltv1^swu54/swu54 + MO4-tp53 (TU)	standard conditions	FIGURE 7 from Zhang et al., 2021

Citations