CRISPR

CRISPR1-alkbh4

ID

ZDB-CRISPR-171122-1

Name

CRISPR1-alkbh4

Previous Names

None

Target

alkbh4 (1)

Sequence

5' - CCATGTGGGAAGCTTCAGCGGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
tsu20	alkbh4
tsu26	alkbh4
tsu28	alkbh4

Expression

Gene expression in Wild Types + CRISPR1-alkbh4

No data available

Phenotype

Phenotype resulting from CRISPR1-alkbh4

No data available

Phenotype of all Fish created by or utilizing CRISPR1-alkbh4

Phenotype	Fish	Conditions	Figures
midbrain alkbh4 expression absent, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
external yolk syncytial layer actomyosin structure organization decreased occurrence, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 4 from Sun et al., 2017
forebrain alkbh4 expression absent, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
otic vesicle alkbh4 expression absent, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
external yolk syncytial layer actomyosin decreased width, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 4 from Sun et al., 2017
blastomere alkbh4 expression absent, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
whole organism decreased length, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
external yolk syncytial layer marginal blastomere shape, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 4 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 3 from Sun et al., 2017
EVL shape, abnormal	alkbh4^tsu20/tsu20	standard conditions	Fig. 4 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	alkbh4^tsu20/+	standard conditions	Fig. 3 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	alkbh4^tsu20/+	standard conditions	Fig. 3 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	alkbh4^tsu20/+	standard conditions	Fig. 3 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
external yolk syncytial layer actomyosin decreased width, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
external yolk syncytial layer marginal blastomere shape, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
external yolk syncytial layer actomyosin structure organization decreased occurrence, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017

Citations