CRISPR

CRISPR1-runx3

ID
ZDB-CRISPR-170921-5
Name
CRISPR1-runx3
Previous Names
None
Target
Sequence
5' - GTGCAACAAAACCCTTCCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
w144 runx3
Expression
Gene expression in Wild Types + CRISPR1-runx3
No data available
Phenotype
Phenotype resulting from CRISPR1-runx3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-runx3
Phenotype Fish Conditions Figures
Rohon-Beard neuron piezo2b expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 8 with image from Gau et al., 2017
trigeminal ganglion ntrk3a expression decreased amount, abnormal runx3w144/w144 (AB) standard conditions Fig. 5 with image from Gau et al., 2017
trigeminal ganglion ntrk3a expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 5 with image from Gau et al., 2017
Rohon-Beard neuron runx3 expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 3 with image from Gau et al., 2017
response to chemical behavioral quality of a process, abnormal runx3w144/w144 (AB) control Fig. 9 from Gau et al., 2017
Rohon-Beard neuron trpa1b expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 8 with image from Gau et al., 2017
trigeminal ganglion piezo2b expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 7 with image from Gau et al., 2017
Rohon-Beard neuron trpa1b expression decreased amount, abnormal runx3w144/w144 (AB) standard conditions Fig. 8 with image from Gau et al., 2017
Rohon-Beard neuron runx1 expression decreased amount, abnormal runx3w144/w144 (AB) standard conditions Fig. 3 with image from Gau et al., 2017
trigeminal ganglion trpa1b expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 7 with image from Gau et al., 2017
Rohon-Beard neuron ntrk3a expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 6 with image from Gau et al., 2017
Rohon-Beard neuron ntrk2a expression increased amount, abnormal runx3w144/w144 (AB) standard conditions Fig. 6 with image from Gau et al., 2017
trigeminal ganglion runx3 expression absent, abnormal runx3w144/w144 (AB) standard conditions Fig. 4 with image from Gau et al., 2017
trigeminal ganglion ntrk2a expression increased amount, abnormal runx3w144/w144 (AB) standard conditions Fig. 5 with image from Gau et al., 2017
Rohon-Beard neuron ntrk3a expression decreased amount, abnormal runx3w144/w144 (AB) standard conditions Fig. 6 with image from Gau et al., 2017
Rohon-Beard neuron EGFP expression decreased amount, abnormal runx3w144/w144; a129Tg (AB) standard conditions Fig. 8 with image from Gau et al., 2017
trigeminal ganglion EGFP expression absent, abnormal runx3w144/w144; a129Tg (AB) standard conditions Fig. 7 with image from Gau et al., 2017
Rohon-Beard neuron EGFP expression absent, abnormal runx3w144/w144; a129Tg (AB) standard conditions Fig. 8 with image from Gau et al., 2017
Citations