ZFIN ID: ZDB-GENE-980526-474 |
Gene Name: | bone morphogenetic protein 2b |
---|---|
Symbol: | bmp2b |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing bmp2b | |
---|---|
CH211-213I16 | Chr: 20 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
sa18243 | 20 | 45,896,039 | GRCz11 | Busch-Nentwich et al., 2013 |
20 | 45,992,319 | GRCz10 | Busch-Nentwich et al., 2013 | |
20 | 46,429,654 | Zv9 | Busch-Nentwich et al., 2013 | |
ta72a | 20 | 45,898,787 | GRCz11 | ZFIN Curated Data |
tc300a | 20 | 45,898,583 | GRCz11 | ZFIN Curated Data |
tdc24 | 20 | 45,895,886 | GRCz11 | ZFIN Curated Data |
zf3958 | 20 | 45,898,287 - 45,898,297 | GRCz11 | Wu et al., 2022 |
bmp2b_unspecified | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
sa18243 | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
ta72a | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
tc300a | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
tdc24 | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
umo34 | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
zf3705Tg | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 | |||
zf3958 | 20 | GRCz11 | ||
20 | GRCz11 | |||
20 | GRCz11 | |||
20 | GRCz11 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
20 | 176.7 cM | bmp2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
20 | 720.06 cR | bmp2b | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
20 | 3812.0 cR | bmp2b | Goodfellow T51 (T51) | Geisler, Robert | Data |
20 | 116.8 cM | bmp2b | Heat Shock (HS) | Woods, Ian G. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
z13626 | SSLP | 20 | Kikuchi et al., 2000 | Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20, ... | |
z20046 | SSLP | 20 | Kikuchi et al., 2000 | Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20, ... | |
mixl1 | GENE | 20 | 3.9 cM | Kikuchi et al., 2000 | Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20, ... |
14p1500 | RAPD | 20 | 14.81 cM | Lee et al., 1998 | Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers. |
9ae.550 | RAPD | 20 | Lee et al., 1998 | Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers. | |
12f580 | RAPD | 20 | Lee et al., 1998 | Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers. |
Genomic Feature ta72a is an allele of bmp2b | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 160 | 36.0 | |
Forward Primer | GCTCAGCCCTATCTCACTGC | ||
Reverse Primer | TTTCTTCCTCCAAAATAGCTCG |
Genomic Feature umo34 is an allele of bmp2b |