ZFIN ID: ZDB-GENE-980526-124 |
Gene Name: | ndrg family member 3a |
---|---|
Symbol: | ndrg3a |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing ndrg3a | |
---|---|
CH211-25D12 | Chr: 11 Details |
CH211-274P22 | Chr: 11 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
sa35087 | 11 | 25,122,422 | GRCz11 | Busch-Nentwich et al., 2013 |
11 | 24,884,806 | GRCz10 | Busch-Nentwich et al., 2013 | |
11 | 26,055,981 | Zv9 | Busch-Nentwich et al., 2013 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
5 | 250.1 cM | ndr3 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
ephb4a | GENE | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. | |
z34450 | SSLP | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. | |
zf232 | Feature | 5 | 0.3 cM | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. |
pax8 | GENE | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. | |
usp39 | GENE | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. |
Markers Encoded by ndrg3a | |||
---|---|---|---|
MGC:63551 Chr: 5 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 126,120 | 36.0 | |
Forward Primer | GTATAGTAGTGTGTATGAGCATCTGG | ||
Reverse Primer | AGCTGACCCGCTC(A/C)GGTT |
Genomic Feature sa35087 is an allele of ndrg3a |