ZFIN ID: ZDB-GENE-980526-404

Mapping Details

Gene Name: forkhead box A2
Symbol: foxa2
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN JBrowse 17 42,565,998 - 42,568,498 GRCz11
Ensembl 17 42,565,998 - 42,568,498 GRCz11
Vega 17 42,290,592 - 42,293,092 GRCv10
NCBI Map Viewer 17 42,565,998 - 42,568,438 GRCz11
UCSC 17 - GRCz11
Mapped Clones containing foxa2
DKEY-208C12 Chr: 17 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 165.0 cM axial Mother of Pearl (MOP) Postlethwait, John H. Data
17 333.51 cR foxa2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
17 4132.0 cR foxa2 Goodfellow T51 (T51) Geisler, Robert Data
17 98.8 cM foxa2 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
tv53a Feature 17 Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the same position as foxa2.

OTHER MAPPING INFORMATION
Chr 17 Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the  ...
Markers Encoded by foxa2
fe05g04 Chr: 17 Details
tdsubc_2g8 Chr: 17 Details
Genomic Feature st20 is an allele of foxa2
Marker Type Chr Distance Publication / Person Comments
z9830 SSLP 17 5.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped molst20 to LG17 using SSLP markers.
z21703 SSLP 17 5.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped molst20 to LG17 using SSLP markers.
Genomic Feature tv53a is an allele of foxa2
Marker Type Chr Distance Publication / Person Comments
z21703 SSLP 17 2.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 using SSLP markers.
z21194 SSLP 17 9.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 using SSLP markers.
foxa2 GENE 17 Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the same position as foxa2.
Genomic Feature tv53a is an allele of foxa2
Chr 17 Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 454 Tsp509I 36.0
Forward Primer GACATACGAGCAAGTGATGCA
Reverse Primer GCGAAAAAAGTCCAAATAACA
Genomic Feature st20 is an allele of foxa2