Genomic Feature
umo72
- ID
- ZDB-ALT-240625-13
- Name
- umo72
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one delins (1)
- Protocol
- embryos treated with
- Lab of Origin
- Wei Ge Lab
- Current Source
- Other Pages
-
Notes
| Comment | Citation |
|---|---|
| Chromosome 5, insertion of GCGGCTGTAATGACTATCTATCTATCTATCTATCTA, and deletion ... | Zebrafish Nomenclature Committee |
Variants
- Variant Type
- Delins
- Variant Location
- Unmapped
- Nucleotide change
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- 34 bp inserted / 2 bp deleted (1)
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None