TALEN

TALEN1-gcgra

ID

ZDB-TALEN-160205-1

Name

TALEN1-gcgra

Previous Names

None

Target

gcgra (1)

Target Sequence 1

5' - GCCCTGCCCAACACTACAGT - 3'

Target Sequence 2

5' - CCTTGTGCCAGGGCAGATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
vu600	gcgra

Expression

Gene expression in Wild Types + TALEN1-gcgra

No data available

Phenotype

Phenotype resulting from TALEN1-gcgra

No data available

Phenotype of all Fish created by or utilizing TALEN1-gcgra

Phenotype	Fish	Conditions	Figures
whole organism gcgra expression decreased amount, abnormal	gcgra^vu600/vu600	standard conditions	Fig. 3 from Li et al., 2015
glucose homeostasis process quality, abnormal	gcgra^vu600/vu600	standard conditions	Fig. 6 from Li et al., 2015
whole organism gcga expression increased amount, abnormal	gcgra^vu600/vu600	standard conditions	Fig. 6 from Li et al., 2015
whole organism gcgrb expression increased amount, abnormal	gcgra^vu600/vu600	standard conditions	Fig. 3 from Li et al., 2015
glucagon secretion increased process quality, abnormal	gcgra^vu600/vu600	standard conditions	Fig. 6 from Li et al., 2015
whole organism gcgb expression increased amount, abnormal	gcgra^vu600/vu600	standard conditions	Fig. 6 from Li et al., 2015
primary islet pancreatic A cell GFP expression increased amount, abnormal	gcgra^vu600/vu600; ia1Tg	standard conditions	Fig. 4, Fig. 5 from Li et al., 2015
pancreatic A cell cell population proliferation increased rate, abnormal	gcgra^vu600/vu600; ia1Tg	standard conditions	Fig. 5 from Li et al., 2015
pancreatic A cell hyperplastic, abnormal	gcgra^vu600/vu600; ia1Tg	standard conditions	Fig. 4 from Li et al., 2015
whole organism pcsk9 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism gcgra expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 3 from Li et al., 2015
whole organism fcsk expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
glucose homeostasis process quality, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 6 from Li et al., 2015
whole organism papss1 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism elovl7b expression increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism methionine decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 6 from Kang et al., 2020
whole organism ndufs8b expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism isoleucine decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 6 from Kang et al., 2020
whole organism gale expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism adh5l expression increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism eevs expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism gcga expression increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 6 from Li et al., 2015
whole organism hadhaa expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism pck2 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 6 from Li et al., 2015
whole organism tyrosine decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 6 from Kang et al., 2020
whole organism g6pc1a.1 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 6 from Li et al., 2015
whole organism dnmt1 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism cox11 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism pvalb3 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism apobb.2 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism fasn2 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
D-glucose import increased process quality, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 5 from Kang et al., 2020
whole organism gcgrb expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 3 from Li et al., 2015
whole organism pck1 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 6 from Li et al., 2015
whole organism lipca expression increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
glucagon secretion increased process quality, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Fig. 6 from Li et al., 2015
whole organism mlycd expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
liver lipid increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 4 from Kang et al., 2020
whole organism acss2l expression increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism slc2a1a expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism cthl expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism il4i1 expression decreased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020
whole organism gcgb expression increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601	standard conditions	Figure 7 from Kang et al., 2020 Fig. 6 from Li et al., 2015
primary islet pancreatic A cell GFP expression increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg	standard conditions	Fig. 4, Fig. 5 from Li et al., 2015
pancreas has extra parts of type pancreatic A cell, ameliorated	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg	chemical treatment by environment: sirolimus	Fig. 3 from Dean et al., 2017
pancreatic A cell amount, ameliorated	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg	chemical treatment: glucose	Figure 5 from Kang et al., 2020
pancreatic A cell increased amount, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg	standard conditions	Figure 5 from Kang et al., 2020
pancreas has extra parts of type pancreatic A cell, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg	standard conditions	Fig. 3 , Fig. 4 from Dean et al., 2017
pancreatic A cell cell population proliferation increased rate, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg	standard conditions	Fig. 5 from Li et al., 2015
pancreatic A cell hyperplastic, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg	standard conditions	Fig. 4 from Li et al., 2015
pancreas has extra parts of type pancreatic A cell, abnormal	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg + CRISPR1-slc38a5a	standard conditions	Fig. 4 from Dean et al., 2017
pancreas has extra parts of type pancreatic A cell, ameliorated	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg + CRISPR1-slc38a5b	standard conditions	Fig. 4 from Dean et al., 2017
pancreas has extra parts of type pancreatic A cell, ameliorated	gcgra^vu600/vu600; gcgrb^vu601/vu601; ia1Tg + CRISPR1-slc38a5a + CRISPR1-slc38a5b	standard conditions	Fig. 4 from Dean et al., 2017

Citations