TALEN

TALEN1-irf8

ID
ZDB-TALEN-150428-1
Name
TALEN1-irf8
Previous Names
None
Target
Target Sequence 1
5' - TGAAGTAAAGGTCTACAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - TATAAGCCACTGTTTCAGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
st95 irf8
st96 irf8
Expression
Gene expression in Wild Types + TALEN1-irf8
No data available
Phenotype
Phenotype resulting from TALEN1-irf8
No data available
Phenotype of all Fish created by or utilizing TALEN1-irf8
Phenotype Fish Conditions Figures
whole organism tnfa expression increased amount, abnormal irf8st95/st95 transection: spinal cord Fig. 4 from Tsarouchas et al., 2018
response to fungus process quality, abnormal irf8st95/st95 fungal treatment by injection: Cryptococcus neoformans Fig. 2 from Davis et al., 2016
whole organism tgfb1a expression decreased amount, abnormal irf8st95/st95 transection: spinal cord Fig. 4 from Tsarouchas et al., 2018
hematopoietic cell lgals3bp.1 expression absent, abnormal irf8st95/st95 standard conditions Fig. 5 with image from Rovira et al., 2022
microglial cell absent, abnormal irf8st95/st95 standard conditions Fig. 1 with image from Shiau et al., 2015
trunk macrophage mpeg1.1 expression absent, abnormal irf8st95/st95 transection: spinal cord Fig. 2 from Tsarouchas et al., 2018
regenerating tissue il1b expression increased amount, abnormal irf8st95/st95 transection: spinal cord Fig. 8 from Tsarouchas et al., 2018
whole organism il1b expression decreased amount, abnormal irf8st95/st95 transection: spinal cord, chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor Fig. 7 from Tsarouchas et al., 2018
whole organism dead, abnormal irf8st95/st95 fungal treatment by injection: Aspergillus fumigatus Fig. 7 from Jain et al., 2018
macrophage absent, abnormal irf8st95/st95 fungal treatment by injection: Cryptococcus neoformans Fig. 2 from Davis et al., 2016
trunk ventral region mpeg1.1 expression absent, abnormal irf8st95/st95 standard conditions Fig. 2 from Tsarouchas et al., 2018
regenerating tissue macrophage mpeg1.1 expression absent, abnormal irf8st95/st95 transection: spinal cord Fig. 2 from Tsarouchas et al., 2018
whole organism decreased life span, abnormal irf8st95/st95 fungal treatment by injection: Aspergillus fumigatus Fig. 7 from Jain et al., 2018
optic tectum lgals3bp.1 expression absent, abnormal irf8st95/st95 standard conditions Fig. 5 with image from Rovira et al., 2022
retina lgals3bp.1 expression absent, abnormal irf8st95/st95 standard conditions Fig. 5 with image from Rovira et al., 2022
optic tectum apoptotic cell clearance decreased occurrence, abnormal irf8st95/st95 standard conditions Fig. 4 with image from Shen et al., 2016
macrophage absent, abnormal irf8st95/st95 standard conditions Fig. 2 from Tsarouchas et al., 2018
Fig. 2 with image,  Fig. 5 with image from Shiau et al., 2015
trunk macrophage mpeg1.1 expression absent, abnormal irf8st95/st95 standard conditions Fig. 2 from Tsarouchas et al., 2018
macrophage absent, abnormal irf8st95/st95 transection: spinal cord Fig. 2 from Tsarouchas et al., 2018
axon regeneration occurrence, ameliorated irf8st95/st95 transection: spinal cord, chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor Fig. 7 from Tsarouchas et al., 2018
brain lacks all parts of type microglial cell, abnormal irf8st95/st95 standard conditions Fig. 4 with image from Shen et al., 2016
neutrophil increased amount, abnormal irf8st95/st95 standard conditions Fig. 2 with image from Shiau et al., 2015
locomotion process quality, ameliorated irf8st95/st95 transection: spinal cord, chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor Fig. 7 from Tsarouchas et al., 2018
cell death increased occurrence, abnormal irf8st95/st95 transection: spinal cord Fig. 7 from Tsarouchas et al., 2018
regenerating tissue neutrophil decreased amount, abnormal irf8st95/st95 transection: spinal cord, chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor Fig. 7 from Tsarouchas et al., 2018
trunk ventral region mpeg1.1 expression absent, abnormal irf8st95/st95 transection: spinal cord Fig. 2 from Tsarouchas et al., 2018
retina lacks all parts of type microglial cell, abnormal irf8st95/st95 standard conditions Fig. 11 from Fogerty et al., 2022
axon regeneration decreased occurrence, abnormal irf8st95/st95 transection: spinal cord, chemical treatment by environment: pomalidomide Fig. 5 from Tsarouchas et al., 2018
optic tectum ab-4c4 labeling absent, abnormal irf8st95/st95 standard conditions Fig. 5 with image from Rovira et al., 2022
cell death increased occurrence, ameliorated irf8st95/st95 transection: spinal cord, chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor Fig. 7 from Tsarouchas et al., 2018
whole organism tnfa expression decreased amount, abnormal irf8st95/st95 transection: spinal cord, chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor Fig. 7 from Tsarouchas et al., 2018
whole organism tgfb3 expression decreased amount, abnormal irf8st95/st95 transection: spinal cord Fig. 4 from Tsarouchas et al., 2018
axon regeneration decreased occurrence, abnormal irf8st95/st95 transection: spinal cord Fig. 2,  Fig. 5,  Fig. 7,  Fig. 9 from Tsarouchas et al., 2018
regenerating tissue neutrophil increased amount, abnormal irf8st95/st95 transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
locomotion decreased process quality, abnormal irf8st95/st95 transection: spinal cord Fig. 2,  Fig. 7 from Tsarouchas et al., 2018
whole organism il1b expression increased amount, abnormal irf8st95/st95 transection: spinal cord Fig. 4,  Fig. 8 from Tsarouchas et al., 2018
retina has fewer parts of type microglial cell, abnormal irf8st95/st95 standard conditions Fig. 10 from Fogerty et al., 2022
defense response to bacterium decreased efficacy, abnormal irf8st95/st95 (AB) bacterial treatment by injection: Mycobacterium marinum, chemical treatment by environment: clemastine fumarate Fig. 2 with image from Matty et al., 2019
defense response to bacterium decreased efficacy, abnormal irf8st95/st95 (AB) bacterial treatment by injection: Mycobacterium marinum Fig. 2 with image from Matty et al., 2019
blood island macrophage absent, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 4 with image from Shiau et al., 2015
macrophage decreased amount, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 3 with image from Shiau et al., 2015
head macrophage decreased amount, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 4 with image from Shiau et al., 2015
gut myeloid cell decreased amount, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 6 from Ferrero et al., 2020
macrophage immature, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 3 with image from Shiau et al., 2015
spleen myeloid cell decreased amount, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 6 from Ferrero et al., 2020
head macrophage absent, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 4 with image from Shiau et al., 2015
blood island macrophage decreased amount, abnormal irf8st95/st95; gl22Tg standard conditions Fig. 4 with image from Shiau et al., 2015
regenerating tissue neutrophil EGFP expression increased amount, abnormal irf8st95/st95; sh445Tg transection: spinal cord Fig. 8 from Tsarouchas et al., 2018
regenerating tissue macrophage EGFP expression absent, abnormal irf8st95/st95; sh445Tg transection: spinal cord Fig. 8 from Tsarouchas et al., 2018
regenerating tissue keratinocyte EGFP expression increased amount, abnormal irf8st95/st95; sh445Tg transection: spinal cord Fig. 8 from Tsarouchas et al., 2018
regenerating tissue microglial cell EGFP expression absent, abnormal irf8st95/st95; sh445Tg transection: spinal cord Fig. 8 from Tsarouchas et al., 2018
spinal cord axon regeneration decreased occurrence, abnormal irf8st95/st95; zf148Tg (WIK) surgical manipulation: spinal cord Figure 3 with image from Oprişoreanu et al., 2023
spinal cord axon regeneration normal occurrence, ameliorated irf8st95/st95; zf148Tg (WIK) surgical manipulation: spinal cord, chemical treatment by environment: cimetidine Figure 3 with image from Oprişoreanu et al., 2023
myeloid cell cell death increased process quality, abnormal irf8st95/st95; zf149Tg standard conditions Fig. 3 with image from Shiau et al., 2015
blood island cell death increased process quality, abnormal irf8st95/st95; zf149Tg standard conditions Fig. 3 with image from Shiau et al., 2015
axon regeneration occurrence, ameliorated irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
whole organism il1b expression decreased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
locomotion process quality, ameliorated irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
whole organism tnfa expression decreased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
regenerating tissue neutrophil increased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
retina has number of retinal cone cell, ameliorated cep290fh297/fh297; irf8st95/st95 standard conditions Fig. 11 from Fogerty et al., 2022
retina cell population proliferation process quality, ameliorated cep290fh297/fh297; irf8st95/st95 standard conditions Fig. 11 from Fogerty et al., 2022
retina lacks all parts of type microglial cell, abnormal cep290fh297/fh297; irf8st95/st95 standard conditions Fig. 11 from Fogerty et al., 2022
whole organism decreased life span, exacerbated irf8st95/+; zf307Tg bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 6 from Rosowski et al., 2016
whole organism decreased life span, exacerbated irf8st95/st95; zf307Tg bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 6 from Rosowski et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.