Morpholino

MO2-krt18a.1

ID

ZDB-MRPHLNO-250224-4

Name

MO2-krt18a.1

Previous Names

None

Target

krt18a.1 (1)

Sequence

5' - GTAGCTTGTTCTCAGACTCATGGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-krt18a.1

No data available

Phenotype

Phenotype resulting from MO2-krt18a.1

No data available

Phenotype of all Fish created by or utilizing MO2-krt18a.1

Phenotype	Fish	Conditions	Figures
eye absence of anatomical entity, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO2-krt18a.1	control	Fig. 3 from Williams et al., 2024
eye decreased size, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO2-krt18a.1	control	Fig. 3 from Williams et al., 2024
optic furrow open, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO2-krt18a.1	control	Fig. 3 from Williams et al., 2024
ventral mandibular arch absence of anatomical entity, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO2-krt18a.1	control	Fig. 3 from Williams et al., 2024
pharyngeal arch absence of anatomical entity, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO2-krt18a.1	control	Fig. 3 from Williams et al., 2024
optic cup peripheral region disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; ba2Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
optic cup neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; ba2Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
periocular mesenchyme neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; ba2Tg + MO2-krt18a.1	control	Fig. 4 , Fig. 5 from Williams et al., 2024
eye anterior region disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; ba2Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
eye neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; ba2Tg + MO2-krt18a.1	control	Fig. 4 , Fig. 5 from Williams et al., 2024
periocular mesenchyme disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; ba2Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
optic cup peripheral region disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf15Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
periocular mesenchyme disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf15Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
optic cup neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf15Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
periocular mesenchyme neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf15Tg + MO2-krt18a.1	control	Fig. 4 , Fig. 5 from Williams et al., 2024
eye anterior region disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf15Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
eye neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf15Tg + MO2-krt18a.1	control	Fig. 4 , Fig. 5 from Williams et al., 2024
optic cup peripheral region disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf460Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
eye anterior region disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf460Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
periocular mesenchyme disorganized, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf460Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
optic cup neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf460Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
periocular mesenchyme neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf460Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024
eye neural crest cell migration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; zf460Tg + MO2-krt18a.1	control	Fig. 5 from Williams et al., 2024

Citations