Morpholino

MO1-six2b

ID

ZDB-MRPHLNO-240913-1

Name

MO1-six2b

Previous Names

None

Target

Sequence

5' - GCCTCAATAAGTTCTCCTACCTTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-six2b

Expressed Gene	Anatomy	Figures
cdh17	pronephric proximal convoluted tubule pronephric tubule epithelium	Figure 2 from Belcher et al., 2023
nphs1	pronephric glomerulus	Figure 2 from Belcher et al., 2023
nphs2	pronephric glomerulus	Figure 2 from Belcher et al., 2023
pax2a	pronephric tubule	Figure 2 from Belcher et al., 2023
slc20a1a	pronephric proximal convoluted tubule	Figure 2 from Belcher et al., 2023
trpm7	pronephric proximal straight tubule	Figure 2 from Belcher et al., 2023
wt1a	pronephric glomerulus	Figure 2 from Belcher et al., 2023

Phenotype

Phenotype resulting from MO1-six2b

Phenotype	Fish	Figures
pronephric glomerulus wt1a expression increased distribution, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs2 expression increased distribution, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs1 expression increased distribution, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric glomerulus wt1a expression spatial pattern, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs1 expression spatial pattern, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs2 expression spatial pattern, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric proximal convoluted tubule cdh17 expression decreased distribution, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023
pronephric tubule pax2a expression spatial pattern, abnormal	AB + MO1-six2b	Figure 2 from Belcher et al., 2023

Phenotype of all Fish created by or utilizing MO1-six2b

Phenotype	Fish	Conditions	Figures
pronephric glomerulus wt1a expression spatial pattern, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs1 expression spatial pattern, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric tubule pax2a expression spatial pattern, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric glomerulus wt1a expression increased distribution, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs1 expression increased distribution, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs2 expression increased distribution, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric proximal convoluted tubule cdh17 expression decreased distribution, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023
pronephric glomerulus nphs2 expression spatial pattern, abnormal	AB + MO1-six2b	control	Figure 2 from Belcher et al., 2023

Citations