Morpholino

MO1-tpcn1

ID

ZDB-MRPHLNO-230317-1

Name

MO1-tpcn1

Previous Names

None

Target

tpcn1 (1)

Sequence

5' - GTAGCGGATCAGATAATGACCTGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tpcn1

No data available

Phenotype

Phenotype resulting from MO1-tpcn1

Phenotype	Fish	Figures
smooth muscle cell endolysosome irregular spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	Fig. 5 from Rice et al., 2022
somite 8 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	Fig. 6 from Rice et al., 2022
somite 9 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	Fig. 6 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	Fig. 1, Fig. 2 from Rice et al., 2022
trunk musculature calcium-mediated signaling decreased process quality, abnormal	hkz100Tg/hkz100Tg + MO1-tpcn1 + MO4-tp53	Fig. 7 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	Fig. 1, Fig. 2 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	Fig. 5 from Rice et al., 2022

Phenotype of all Fish created by or utilizing MO1-tpcn1

Phenotype	Fish	Conditions	Figures
trunk musculature calcium-mediated signaling decreased process quality, abnormal	hkz100Tg/hkz100Tg + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 7 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, ameliorated	AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53	standard conditions	Fig. 1 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, ameliorated	AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53	standard conditions	Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, ameliorated	AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53	standard conditions	Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53	standard conditions	Fig. 2 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 1, Fig. 2 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 1 from Rice et al., 2022
somite 9 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 6 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 5 from Rice et al., 2022
smooth muscle cell endolysosome irregular spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 5 from Rice et al., 2022
somite 8 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 6 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, abnormal	AB + MO1-tpcn1 + MO4-tp53	standard conditions	Fig. 1, Fig. 2 from Rice et al., 2022

Citations