Morpholino

MO4-grhl3

ID
ZDB-MRPHLNO-221219-1
Name
MO4-grhl3
Previous Names
None
Target
Sequence
5' - TGGTCATGACTCCTTGTACAGGCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-grhl3
Expressed Gene Anatomy Figures
cdh1 Fig 7 with image from Phatak et al., 2021
Phenotype
Phenotype resulting from MO4-grhl3
Phenotype Fish Figures
epidermal cell decreased thickness, abnormal zf106Tg/zf106Tg + MO4-grhl3 Fig 6 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, abnormal zf106Tg/zf106Tg + MO4-grhl3 Fig 6 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO4-grhl3 Fig 7 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, abnormal TU + MO4-grhl3 Fig 4 with image,  Fig 5 with image from Phatak et al., 2021
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO4-grhl3 Fig 6 with image from Phatak et al., 2021
Phenotype of all Fish created by or utilizing MO4-grhl3
Phenotype Fish Conditions Figures
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell decreased thickness, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, abnormal TU + MO4-grhl3 standard conditions Fig 4 with image,  Fig 5 with image from Phatak et al., 2021
epidermal cell cdh1 expression amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell decreased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, exacerbated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell cell division increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, exacerbated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 5 with image from Phatak et al., 2021
epidermal cell delamination normal frequency, ameliorated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.