Morpholino

MO4-badb

ID
ZDB-MRPHLNO-220325-1
Name
MO4-badb
Previous Names
None
Target
Sequence
5' - CAGAGATATTAAACATATGTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-badb
Expressed Gene Anatomy Figures
casp8 Figure 2 with image from Hung et al., 2021
cat Figure 3 with image from Hung et al., 2021
nfe2l2a Figure 3 with image from Hung et al., 2021
nfe2l2b Figure 3 with image from Hung et al., 2021
sod1 Figure 3 with image from Hung et al., 2021
sod2 Figure 3 with image from Hung et al., 2021
tp53 Figure 2 with image from Hung et al., 2021
Phenotype
Phenotype resulting from MO4-badb
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO4-badb Figure 2 with image from Hung et al., 2021
brain increased width, abnormal AB + MO4-badb Figure 5 with image from Hung et al., 2021
brain morphology, abnormal AB + MO4-badb Figure 5 with image from Hung et al., 2021
brain shortened, abnormal AB + MO4-badb Figure 5 with image from Hung et al., 2021
brain development process quality, abnormal AB + MO4-badb Figure 5 with image from Hung et al., 2021
formation of primary germ layer process quality, abnormal AB + MO4-badb Figure 4 with image from Hung et al., 2021
hindbrain morphology, abnormal AB + MO4-badb Figure 6 with image from Hung et al., 2021
midbrain morphology, abnormal AB + MO4-badb Figure 6 with image from Hung et al., 2021
reactive oxygen species biosynthetic process increased process quality, abnormal AB + MO4-badb Figure 3 with image from Hung et al., 2021
swimming decreased process quality, abnormal AB + MO4-badb Figure 7 with image from Hung et al., 2021
whole organism cat expression increased amount, abnormal AB + MO4-badb Figure 3 with image from Hung et al., 2021
whole organism sod1 expression increased amount, abnormal AB + MO4-badb Figure 3 with image from Hung et al., 2021
whole organism sod2 expression increased amount, abnormal AB + MO4-badb Figure 3 with image from Hung et al., 2021
whole organism tp53 expression increased amount, abnormal AB + MO4-badb Figure 2 with image from Hung et al., 2021
whole organism nfe2l2b expression increased amount, abnormal AB + MO4-badb Figure 3 with image from Hung et al., 2021
whole organism casp8 expression increased amount, abnormal AB + MO4-badb Figure 2 with image from Hung et al., 2021
whole organism nfe2l2a expression increased amount, abnormal AB + MO4-badb Figure 3 with image from Hung et al., 2021
Phenotype of all Fish created by or utilizing MO4-badb
Phenotype Fish Conditions Figures
whole organism sod1 expression increased amount, abnormal AB + MO4-badb standard conditions Figure 3 with image from Hung et al., 2021
brain development process quality, abnormal AB + MO4-badb standard conditions Figure 5 with image from Hung et al., 2021
brain morphology, abnormal AB + MO4-badb standard conditions Figure 5 with image from Hung et al., 2021
brain increased width, abnormal AB + MO4-badb standard conditions Figure 5 with image from Hung et al., 2021
formation of primary germ layer process quality, abnormal AB + MO4-badb standard conditions Figure 4 with image from Hung et al., 2021
apoptotic process increased occurrence, abnormal AB + MO4-badb standard conditions Figure 2 with image from Hung et al., 2021
whole organism cat expression increased amount, abnormal AB + MO4-badb standard conditions Figure 3 with image from Hung et al., 2021
midbrain morphology, abnormal AB + MO4-badb standard conditions Figure 6 with image from Hung et al., 2021
swimming decreased process quality, abnormal AB + MO4-badb standard conditions Figure 7 with image from Hung et al., 2021
whole organism casp8 expression increased amount, abnormal AB + MO4-badb standard conditions Figure 2 with image from Hung et al., 2021
whole organism sod2 expression increased amount, abnormal AB + MO4-badb standard conditions Figure 3 with image from Hung et al., 2021
whole organism nfe2l2a expression increased amount, abnormal AB + MO4-badb standard conditions Figure 3 with image from Hung et al., 2021
hindbrain morphology, abnormal AB + MO4-badb standard conditions Figure 6 with image from Hung et al., 2021
brain shortened, abnormal AB + MO4-badb standard conditions Figure 5 with image from Hung et al., 2021
reactive oxygen species biosynthetic process increased process quality, abnormal AB + MO4-badb standard conditions Figure 3 with image from Hung et al., 2021
whole organism tp53 expression increased amount, abnormal AB + MO4-badb standard conditions Figure 2 with image from Hung et al., 2021
whole organism nfe2l2b expression increased amount, abnormal AB + MO4-badb standard conditions Figure 3 with image from Hung et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.