Morpholino

MO3-ccn6

ID

ZDB-MRPHLNO-211029-1

Name

MO3-ccn6

Previous Names

None

Target

Sequence

5' - GTAGTGATAGCATCATACACGGCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-ccn6

Expressed Gene	Anatomy	Figures
vdac1	skeletal muscle	FIGURE 3 from Sengupta et al., 2021
ccn6	skeletal muscle	FIGURE 2 from Sengupta et al., 2021

Phenotype

Phenotype resulting from MO3-ccn6

Phenotype	Fish	Figures
skeletal muscle vdac1 expression decreased amount, abnormal	AB + MO3-ccn6	FIGURE 3 from Sengupta et al., 2021
skeletal muscle ccn6 expression decreased amount, abnormal	AB + MO3-ccn6	FIGURE 2 from Sengupta et al., 2021
skeletal muscle inflamed, abnormal	AB + MO3-ccn6	FIGURE 3 from Sengupta et al., 2021
skeletal muscle ATP decreased amount, abnormal	AB + MO3-ccn6	FIGURE 2 from Sengupta et al., 2021
skeletal muscle NADH increased amount, abnormal	AB + MO3-ccn6	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell irregular spatial pattern, abnormal	AB + MO3-ccn6	FIGURE 3 from Sengupta et al., 2021
skeletal muscle cell proton-transporting ATP synthase complex decreased amount, abnormal	AB + MO3-ccn6	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell respiratory chain complex I decreased amount, abnormal	AB + MO3-ccn6	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell respiratory chain complex III decreased amount, abnormal	AB + MO3-ccn6	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell respiratory chain complex IV decreased amount, abnormal	AB + MO3-ccn6	FIGURE 2 from Sengupta et al., 2021

Phenotype of all Fish created by or utilizing MO3-ccn6

Phenotype	Fish	Conditions	Figures
skeletal muscle ATP decreased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 2 from Sengupta et al., 2021
skeletal muscle NADH increased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 2 from Sengupta et al., 2021
skeletal muscle vdac1 expression decreased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 3 from Sengupta et al., 2021
skeletal muscle inflamed, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 3 from Sengupta et al., 2021
skeletal muscle cell respiratory chain complex III decreased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell irregular spatial pattern, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 3 from Sengupta et al., 2021
skeletal muscle ccn6 expression decreased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell respiratory chain complex IV decreased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell proton-transporting ATP synthase complex decreased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 2 from Sengupta et al., 2021
skeletal muscle cell respiratory chain complex I decreased amount, abnormal	AB + MO3-ccn6	standard conditions	FIGURE 2 from Sengupta et al., 2021

Citations