Morpholino

MO1-h2az2a

ID
ZDB-MRPHLNO-200909-3
Name
MO1-h2az2a
Previous Names
  • Z.2 MO (1)
Target
Sequence
5' - CCACCTGCCATTTCAGCGATGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-h2az2a
Expressed Gene Anatomy Figures
crestin Fig. 1 with image from Raja et al., 2020
dct Fig. 2 with image from Raja et al., 2020
egr2b Fig. 2 with image from Raja et al., 2020
foxd3 Fig. 1 with image from Raja et al., 2020
kita Fig. 2 with image from Raja et al., 2020
mbpa Fig. 2 with image from Raja et al., 2020
mitfa Fig. 3 with image from Raja et al., 2020
sox10 Fig. 1 with image from Raja et al., 2020
tfap2a Fig. 1 with image from Raja et al., 2020
Phenotype
Phenotype resulting from MO1-h2az2a
Phenotype Fish Figures
head melanocyte decreased amount, abnormal WT + MO1-h2az2a Fig. 3 with image from Raja et al., 2020
lateral line melanocyte decreased amount, abnormal WT + MO1-h2az2a Fig. 1 with image,  Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell mbpa expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell GFP expression decreased amount, abnormal zf15Tg + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell egr2b expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
melanoblast decreased amount, abnormal w47Tg + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
melanocyte kita expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
melanocyte mitfa expression decreased amount, abnormal WT + MO1-h2az2a Fig. 3 with image from Raja et al., 2020
melanocyte decreased amount, abnormal WT + MO1-h2az2a Fig. 1 with image,  Fig. 3 with image from Raja et al., 2020
melanocyte dct expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
neural crest cell decreased amount, abnormal ba2Tg + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
pigmentation decreased occurrence, abnormal WT + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
spinal cord CNS neuron (sensu Vertebrata) mislocalised, abnormal zf148Tg + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
whole organism Ab3-h2a labeling decreased amount, abnormal WT + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
Phenotype of all Fish created by or utilizing MO1-h2az2a
Phenotype Fish Conditions Figures
head melanocyte decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
melanocyte mitfa expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
melanocyte decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
lateral line myelinating Schwann cell decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
lateral line melanocyte decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 1 with image,  Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell mbpa expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell egr2b expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
pigmentation decreased occurrence, abnormal WT + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
melanocyte kita expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
melanocyte dct expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
whole organism Ab3-h2a labeling decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
neural crest cell decreased amount, abnormal ba2Tg + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
melanoblast decreased amount, abnormal w47Tg + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
melanocyte decreased amount, abnormal w47Tg + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
lateral line myelinating Schwann cell decreased amount, abnormal zf15Tg + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell GFP expression decreased amount, abnormal zf15Tg + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
spinal cord CNS neuron (sensu Vertebrata) mislocalised, abnormal zf148Tg + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
melanocyte decreased amount, abnormal zf3349Tg + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.