Morpholino

MO3-trpv4

ID
ZDB-MRPHLNO-200821-1
Name
MO3-trpv4
Previous Names
None
Target
Sequence
5' - AGTAGAGTGGAAGCAGAAAAACCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-trpv4
Expressed Gene Anatomy Figures
atp6v1aa Fig. 4 from Liu et al., 2020
oxt Fig. 2 from Liu et al., 2020
slc12a10.2 Fig. 4 from Liu et al., 2020
trpv6 Fig. 4 from Liu et al., 2020
Phenotype
Phenotype resulting from MO3-trpv4
Phenotype Fish Figures
ball acid secretion decreased occurrence, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
epidermal stem cell decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
epidermal stem cell decreased amount, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
integument acid secretion decreased occurrence, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
NaK ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
NaK ionocyte decreased amount, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
vH ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
vH ionocyte decreased amount, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
vH ionocyte acid secretion decreased occurrence, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
whole organism slc12a10.2 expression decreased amount, abnormal AB + MO3-trpv4 Fig. 4 from Liu et al., 2020
whole organism trpv6 expression decreased amount, abnormal AB + MO3-trpv4 Fig. 4 from Liu et al., 2020
whole organism atp6v1aa expression decreased amount, abnormal AB + MO3-trpv4 Fig. 4 from Liu et al., 2020
whole organism oxt expression decreased amount, abnormal AB + MO3-trpv4 Fig. 2 from Liu et al., 2020
whole organism calcium(2+) decreased amount, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
whole organism chloride decreased amount, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
whole organism sodium(1+) decreased amount, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
Phenotype of all Fish created by or utilizing MO3-trpv4
Phenotype Fish Conditions Figures
whole organism slc12a10.2 expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 4 from Liu et al., 2020
whole organism atp6v1aa expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 4 from Liu et al., 2020
integument acid secretion decreased occurrence, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
epidermal stem cell decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
whole organism trpv6 expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 4 from Liu et al., 2020
NaK ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
ball acid secretion decreased occurrence, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
whole organism sodium(1+) decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
whole organism oxt expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 2 from Liu et al., 2020
vH ionocyte decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
whole organism calcium(2+) decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
vH ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
NaK ionocyte decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
epidermal stem cell decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
whole organism chloride decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
vH ionocyte acid secretion decreased occurrence, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.