Morpholino

MO3-lrrc8aa

ID

ZDB-MRPHLNO-200618-2

Name

MO3-lrrc8aa

Previous Names

Target

Sequence

5' - TTCTTTATCTCAAACGCACCTTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-lrrc8aa

Expressed Gene	Anatomy	Figures
myb	whole organism	Fig. 3. from Tseng et al., 2020
spi1b	whole organism	Fig. 3. from Tseng et al., 2020

Phenotype

Phenotype resulting from MO3-lrrc8aa

Phenotype	Fish	Figures
blood circulation decreased process quality, abnormal	AB + MO3-lrrc8aa	Fig. 3. from Tseng et al., 2020
blood island increased accumulation post-vent region, abnormal	AB + MO3-lrrc8aa	Fig. 3. from Tseng et al., 2020
tectal ventricle decreased area, abnormal	AB + MO3-lrrc8aa	Fig. 4. , Fig. 6. from Tseng et al., 2020
third ventricle decreased area, abnormal	AB + MO3-lrrc8aa	Fig. 4. , Fig. 6. from Tseng et al., 2020
ventricular system uninflated, abnormal	AB + MO3-lrrc8aa	Fig. 4. from Tseng et al., 2020
whole organism myb expression decreased amount, abnormal	AB + MO3-lrrc8aa	Fig. 3. from Tseng et al., 2020
whole organism spi1b expression increased amount, abnormal	AB + MO3-lrrc8aa	Fig. 3. from Tseng et al., 2020

Phenotype of all Fish created by or utilizing MO3-lrrc8aa

Phenotype	Fish	Conditions	Figures
whole organism spi1b expression increased amount, abnormal	AB + MO3-lrrc8aa	standard conditions	Fig. 3. from Tseng et al., 2020
tectal ventricle area, ameliorated	AB + MO3-lrrc8aa	chemical treatment by environment: taurine	Fig. 6. from Tseng et al., 2020
blood circulation decreased process quality, abnormal	AB + MO3-lrrc8aa	standard conditions	Fig. 3. from Tseng et al., 2020
third ventricle area, ameliorated	AB + MO3-lrrc8aa	chemical treatment by environment: taurine	Fig. 6. from Tseng et al., 2020
whole organism myb expression decreased amount, abnormal	AB + MO3-lrrc8aa	standard conditions	Fig. 3. from Tseng et al., 2020
third ventricle decreased area, abnormal	AB + MO3-lrrc8aa	standard conditions	Fig. 4. , Fig. 6. from Tseng et al., 2020
ventricular system uninflated, abnormal	AB + MO3-lrrc8aa	standard conditions	Fig. 4. from Tseng et al., 2020
blood island increased accumulation post-vent region, abnormal	AB + MO3-lrrc8aa	standard conditions	Fig. 3. from Tseng et al., 2020
tectal ventricle decreased area, abnormal	AB + MO3-lrrc8aa	standard conditions	Fig. 4. , Fig. 6. from Tseng et al., 2020

Citations