Morpholino

MO2-agbl2

ID
ZDB-MRPHLNO-190904-1
Name
MO2-agbl2
Previous Names
None
Target
Sequence
5' - AAGGATCGTCTGATTTCTTCTGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-agbl2
Expressed Gene Anatomy Figures
aldocb Fig. 5 from Maimouni et al., 2019
eno1a Fig. 5 from Maimouni et al., 2019
pgam1a Fig. 5 from Maimouni et al., 2019
pgk1 Fig. 5 from Maimouni et al., 2019
Phenotype
Phenotype resulting from MO2-agbl2
Phenotype Fish Figures
hindbrain granular, abnormal WT + MO2-agbl2 Fig. 2 with image,  text only from Maimouni et al., 2019
hindbrain opaque, abnormal WT + MO2-agbl2 + MO4-tp53 Fig. 2 with image,  text only from Maimouni et al., 2019
midbrain granular, abnormal WT + MO2-agbl2 Fig. 2 with image,  text only from Maimouni et al., 2019
midbrain opaque, abnormal WT + MO2-agbl2 Fig. 2 with image,  text only from Maimouni et al., 2019
whole organism eno1a expression decreased amount, abnormal WT + MO2-agbl2 Fig. 5 from Maimouni et al., 2019
whole organism pgam1a expression decreased amount, abnormal WT + MO2-agbl2 Fig. 5 from Maimouni et al., 2019
whole organism pgk1 expression decreased amount, abnormal WT + MO2-agbl2 Fig. 5 from Maimouni et al., 2019
whole organism aldocb expression decreased amount, abnormal WT + MO2-agbl2 Fig. 5 from Maimouni et al., 2019
whole organism decreased size, abnormal WT + MO2-agbl2 + MO4-tp53 Fig. 2 with image from Maimouni et al., 2019
whole organism morphology, abnormal WT + MO2-agbl2 + MO4-tp53 Fig. 2 with image from Maimouni et al., 2019
whole organism apoptotic process increased occurrence, abnormal WT + MO2-agbl2 + MO4-tp53 Fig. 2 with image from Maimouni et al., 2019
whole organism cell death increased occurrence, abnormal WT + MO2-agbl2 Fig. 2 with image,  text only from Maimouni et al., 2019
Phenotype of all Fish created by or utilizing MO2-agbl2
Phenotype Fish Conditions Figures
whole organism pgam1a expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
whole organism aldocb expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
midbrain granular, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
hindbrain granular, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
whole organism pgk1 expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
whole organism cell death increased occurrence, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
whole organism eno1a expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
midbrain opaque, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
hindbrain opaque, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
whole organism apoptotic process increased occurrence, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism decreased size, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
midbrain granular, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
hindbrain opaque, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism cell death increased occurrence, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism morphology, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
midbrain opaque, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
hindbrain granular, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.