Morpholino

MO2-hey2

ID

ZDB-MRPHLNO-190401-1

Name

MO2-hey2

Previous Names

None

Target

Sequence

5' - TGCTGTCCTCACAGGGCCGCTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-hey2

Expressed Gene	Anatomy	Figures
hey2	pharyngeal mesoderm	Fig. 7 from Gibb et al., 2018
tbx1	pharyngeal mesoderm	Fig. 7 from Gibb et al., 2018

Phenotype

Phenotype resulting from MO2-hey2

Phenotype	Fish	Figures
atrium cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	Fig. 7 from Gibb et al., 2018
bulbus arteriosus cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	Fig. 7 from Gibb et al., 2018
cardiac muscle cell cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	Fig. 7 from Gibb et al., 2018
cardiac ventricle cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	Fig. 7 from Gibb et al., 2018
pharyngeal mesoderm tbx1 expression increased amount, abnormal	AB/TL + MO2-hey2	Fig. 7 from Gibb et al., 2018
pharyngeal mesoderm hey2 expression increased amount, abnormal	AB/TL + MO2-hey2	Fig. 7 from Gibb et al., 2018
pharyngeal mesoderm tbx1 expression increased distribution, abnormal	AB/TL + MO2-hey2	Fig. 7 from Gibb et al., 2018
pharyngeal mesoderm hey2 expression increased distribution, abnormal	AB/TL + MO2-hey2	Fig. 7 from Gibb et al., 2018

Phenotype of all Fish created by or utilizing MO2-hey2

Phenotype	Fish	Conditions	Figures
pharyngeal mesoderm tbx1 expression increased amount, abnormal	AB/TL + MO2-hey2	standard conditions	Fig. 7 from Gibb et al., 2018
pharyngeal mesoderm hey2 expression increased distribution, abnormal	AB/TL + MO2-hey2	standard conditions	Fig. 7 from Gibb et al., 2018
pharyngeal mesoderm hey2 expression increased amount, abnormal	AB/TL + MO2-hey2	standard conditions	Fig. 7 from Gibb et al., 2018
pharyngeal mesoderm tbx1 expression increased distribution, abnormal	AB/TL + MO2-hey2	standard conditions	Fig. 7 from Gibb et al., 2018
cardiac muscle cell cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	control	Fig. 7 from Gibb et al., 2018
bulbus arteriosus cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	control	Fig. 7 from Gibb et al., 2018
atrium cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	control	Fig. 7 from Gibb et al., 2018
cardiac ventricle cell population proliferation increased occurrence, abnormal	fb7Tg + MO2-hey2	control	Fig. 7 from Gibb et al., 2018

Citations