Morpholino

MO1-efhc2

ID
ZDB-MRPHLNO-190218-1
Name
MO1-efhc2
Previous Names
None
Target
Sequence
5' - GTTTGATTCTGATGGTTCACCTTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-efhc2
Expressed Gene Anatomy Figures
cimap1b Fig. 7 with image from Barrodia et al., 2018
slc12a1 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
slc12a3 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
slc20a1a Fig. 3 with image from Barrodia et al., 2018
stc1 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
trpm7 Fig. 3 with image from Barrodia et al., 2018
Phenotype
Phenotype resulting from MO1-efhc2
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-efhc2 Fig. 2 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression decreased amount, abnormal WT + MO1-efhc2 Fig. 3 with image,  Fig. 4 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression decreased distribution, abnormal WT + MO1-efhc2 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius mislocalised, abnormal WT + MO1-efhc2 Fig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression spatial pattern, abnormal WT + MO1-efhc2 Fig. 5 with image from Barrodia et al., 2018
pericardium edematous, abnormal WT + MO1-efhc2 Fig. 2 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
pronephric distal early tubule increased size, abnormal WT + MO1-efhc2 Fig. 3 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-efhc2 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
pronephric distal late tubule decreased size, abnormal WT + MO1-efhc2 Fig. 3 with image from Barrodia et al., 2018
pronephros decreased functionality, abnormal WT + MO1-efhc2 Fig. 2 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell decreased amount, abnormal WT + MO1-efhc2 Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 Fig. 7 with image from Barrodia et al., 2018
specification of pronephric distal tubule identity process quality, abnormal WT + MO1-efhc2 Fig. 3 with image from Barrodia et al., 2018
Phenotype of all Fish created by or utilizing MO1-efhc2
Phenotype Fish Conditions Figures
corpuscles of Stannius stc1 expression decreased distribution, abnormal WT + MO1-efhc2 control Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius mislocalised, abnormal WT + MO1-efhc2 control Fig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephros decreased functionality, abnormal WT + MO1-efhc2 standard conditions Fig. 2 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 control Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression increased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pericardium edematous, abnormal WT + MO1-efhc2 standard conditions Fig. 2 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression absent, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression spatial pattern, abnormal WT + MO1-efhc2 control Fig. 5 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression spatial pattern, ameliorated WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 control Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression decreased amount, abnormal WT + MO1-efhc2 control Fig. 3 with image,  Fig. 4 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-efhc2 control Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased amount, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 7 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression spatial pattern, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 7 with image from Barrodia et al., 2018
pronephric distal late tubule decreased size, abnormal WT + MO1-efhc2 standard conditions Fig. 3 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 control Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 7 with image from Barrodia et al., 2018
corpuscles of Stannius mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell decreased amount, abnormal WT + MO1-efhc2 control Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 control Fig. 7 with image from Barrodia et al., 2018
pronephric distal early tubule increased size, abnormal WT + MO1-efhc2 standard conditions Fig. 3 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell amount, ameliorated WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell decreased amount, exacerbated WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 7 with image from Barrodia et al., 2018
brain hydrocephalic, abnormal WT + MO1-efhc2 standard conditions Fig. 2 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression spatial pattern, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression increased amount, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
specification of pronephric distal tubule identity process quality, abnormal WT + MO1-efhc2 standard conditions Fig. 3 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.