Morpholino

MO1-cpt1aa

ID
ZDB-MRPHLNO-181102-1
Name
MO1-cpt1aa
Previous Names
None
Target
Sequence
5' - CCACAGCCTGATGAGCTTCTGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cpt1aa
No data available
Phenotype
Phenotype resulting from MO1-cpt1aa
Phenotype Fish Figures
Bruch's membrane increased accumulation Bruch's membrane lipid droplet, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
eye decreased size, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
eye ferroptosis increased occurrence, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
eye malonaldehyde increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
eye reactive oxygen species biosynthetic process increased occurrence, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
eye photoreceptor cell cell death increased occurrence, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
fatty acid beta-oxidation decreased process quality, abnormal y1Tg + MO1-cpt1aa Fig. 1 from Zecchin et al., 2018
lymphangiogenic sprout lymphangiogenesis process quality, abnormal y1Tg + MO1-cpt1aa Fig. 1 from Zecchin et al., 2018
parachordal vessel lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa Fig. 1 from Zecchin et al., 2018
pericardium edematous, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
photoreceptor outer segment layer decreased thickness, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
post-vent region increased curvature, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
retinal inner nuclear layer increased accumulation retinal inner nuclear layer lipid droplet, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
retinal inner nuclear layer intermediate filament vim expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
retinal rod cell rod photoreceptor outer segment rho expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
thoracic duct absent, abnormal y1Tg + MO1-cpt1aa Fig. 2 from Zecchin et al., 2018
thoracic duct lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa Fig. 2 from Zecchin et al., 2018
whole organism cdk1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism opn1mw1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism rpe65a expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism sod1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism ccna2 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism gpx4b expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism gss expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism ccnd1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism opn1lw2 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism rho expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism slc2a1b expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism opn1sw2 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism opn1mw4 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism trarg1b expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism srebf1 expression increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism hif1aa expression increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism ppap2d expression increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism glucose decreased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
yolk increased accumulation yolk lipid droplet, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
Phenotype of all Fish created by or utilizing MO1-cpt1aa
Phenotype Fish Conditions Figures
whole organism opn1mw4 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism ppap2d expression increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism ccna2 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism opn1mw1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
yolk increased accumulation yolk lipid droplet, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
eye decreased size, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism slc2a1b expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism gss expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism rho expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
eye malonaldehyde increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
eye reactive oxygen species biosynthetic process increased occurrence, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism gpx4b expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism glucose decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism trarg1b expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism sod1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism opn1lw2 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
retinal rod cell rod photoreceptor outer segment rho expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism cdk1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism opn1sw2 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
Bruch's membrane increased accumulation Bruch's membrane lipid droplet, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
eye photoreceptor cell cell death increased occurrence, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism hif1aa expression increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
visual behavior process quality, abnormal AB + MO1-cpt1aa lighting conditions Fig. 4 from Ulhaq et al., 2023
post-vent region increased curvature, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
photoreceptor outer segment layer decreased thickness, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism rpe65a expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
pericardium edematous, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
retinal inner nuclear layer increased accumulation retinal inner nuclear layer lipid droplet, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism srebf1 expression increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
retinal inner nuclear layer intermediate filament vim expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism ccnd1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
eye ferroptosis increased occurrence, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
thoracic duct absent, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 2 from Zecchin et al., 2018
fatty acid beta-oxidation decreased process quality, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 1 from Zecchin et al., 2018
parachordal vessel lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 1 from Zecchin et al., 2018
thoracic duct lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 2 from Zecchin et al., 2018
lymphangiogenic sprout lymphangiogenesis process quality, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 1 from Zecchin et al., 2018
eye decreased size, abnormal tp53zdf1/zdf1 + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
retina apoptotic process increased occurrence, abnormal tp53zdf1/zdf1 + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
Citations