Morpholino

MO1-klf9

ID
ZDB-MRPHLNO-180921-3
Name
MO1-klf9
Previous Names
None
Target
Sequence
5' - TGCTGCAATATCTACGTCCGTCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klf9
Expressed Gene Anatomy Figures
cdc5l Fig. 5 from Zhang et al., 2017
cdkn1a Fig. 5 from Zhang et al., 2017
gata1a Fig. S7 from Zhang et al., 2017
hbbe3 Fig. S7 from Zhang et al., 2017
lck Fig. 5 from Zhang et al., 2017
lyz Fig. S7 from Zhang et al., 2017
mcm5 Fig. 5 from Zhang et al., 2017
mfap4.1 Fig. S7 from Zhang et al., 2017
mnd1 Fig. 5 from Zhang et al., 2017
myb Fig. S7 from Zhang et al., 2017
rag1 Fig. 5 from Zhang et al., 2017
tal1 Fig. S7 from Zhang et al., 2017
zw10 Fig. 5 from Zhang et al., 2017
Phenotype
Phenotype resulting from MO1-klf9
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
hematopoietic cell decreased amount, abnormal sd2Tg + MO1-klf9 Fig. 5 from Zhang et al., 2017
nucleate erythrocyte decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
nucleate erythrocyte nucleus size, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
T cell rag1 expression decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
thymus T cell decreased amount, abnormal hkz04tTg + MO1-klf9 Fig. 5 from Zhang et al., 2017
thymus T cell EGFP expression decreased amount, abnormal hkz04tTg + MO1-klf9 Fig. 5 from Zhang et al., 2017
whole organism cdkn1a expression decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
whole organism mnd1 expression decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
whole organism cdc5l expression decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
whole organism zw10 expression decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
whole organism mcm5 expression decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
whole organism lck expression decreased amount, abnormal WT + MO1-klf9 Fig. 5 from Zhang et al., 2017
whole organism DsRed expression decreased amount, abnormal sd2Tg + MO1-klf9 Fig. 5 from Zhang et al., 2017
Phenotype of all Fish created by or utilizing MO1-klf9
Phenotype Fish Conditions Figures
nucleate erythrocyte decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
whole organism lck expression decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
whole organism cdkn1a expression decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
T cell rag1 expression decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
apoptotic process increased occurrence, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
whole organism cdc5l expression decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
whole organism mnd1 expression decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
whole organism zw10 expression decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
whole organism mcm5 expression decreased amount, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
nucleate erythrocyte nucleus size, abnormal WT + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
thymus T cell EGFP expression decreased amount, abnormal hkz04tTg + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
thymus T cell decreased amount, abnormal hkz04tTg + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
hematopoietic cell decreased amount, abnormal sd2Tg + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
whole organism DsRed expression decreased amount, abnormal sd2Tg + MO1-klf9 standard conditions Fig. 5 from Zhang et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.