Morpholino

MO2-ezh2

ID
ZDB-MRPHLNO-180921-1
Name
MO2-ezh2
Previous Names
None
Target
Sequence
5' - CCGATTTCCTCCCGGTCAATCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ezh2
Expressed Gene Anatomy Figures
cry1a Fig. 3 from Zhong et al., 2018
cry1b Fig. 3 from Zhong et al., 2018
lck Fig. 9 from Zhong et al., 2018
myb Fig. 9 from Zhong et al., 2018
per1a Fig. 3 from Zhong et al., 2018
per1b Fig. 3 from Zhong et al., 2018
Phenotype
Phenotype resulting from MO2-ezh2
Phenotype Fish Figures
locomotion involved in locomotory behavior process quality, abnormal WT + MO2-ezh2 Fig. 4 from Zhong et al., 2018
locomotion involved in locomotory behavior rhythm quality, abnormal WT + MO2-ezh2 Fig. 4 from Zhong et al., 2018
whole organism cry1b expression decreased amount, abnormal WT + MO2-ezh2 Fig. 3 from Zhong et al., 2018
whole organism lck expression decreased amount, abnormal WT + MO2-ezh2 Fig. 9 from Zhong et al., 2018
whole organism cry1a expression decreased amount, abnormal WT + MO2-ezh2 Fig. 3 from Zhong et al., 2018
whole organism per1a expression decreased amount, abnormal WT + MO2-ezh2 Fig. 3 from Zhong et al., 2018
whole organism per1b expression decreased amount, abnormal WT + MO2-ezh2 Fig. 3 from Zhong et al., 2018
whole organism myb expression decreased amount, abnormal WT + MO2-ezh2 Fig. 9 from Zhong et al., 2018
Phenotype of all Fish created by or utilizing MO2-ezh2
Phenotype Fish Conditions Figures
locomotion involved in locomotory behavior process quality, abnormal WT + MO2-ezh2 control Fig. 4 from Zhong et al., 2018
whole organism cry1a expression decreased amount, abnormal WT + MO2-ezh2 control Fig. 3 from Zhong et al., 2018
whole organism cry1b expression decreased amount, abnormal WT + MO2-ezh2 control Fig. 3 from Zhong et al., 2018
locomotion involved in locomotory behavior process quality, abnormal WT + MO2-ezh2 constant dark Fig. 4 from Zhong et al., 2018
whole organism per1a expression decreased amount, abnormal WT + MO2-ezh2 control Fig. 3 from Zhong et al., 2018
whole organism myb expression decreased amount, abnormal WT + MO2-ezh2 control Fig. 9 from Zhong et al., 2018
whole organism per1b expression decreased amount, abnormal WT + MO2-ezh2 control Fig. 3 from Zhong et al., 2018
locomotion involved in locomotory behavior rhythm quality, abnormal WT + MO2-ezh2 control Fig. 4 from Zhong et al., 2018
locomotion involved in locomotory behavior rhythm quality, abnormal WT + MO2-ezh2 constant dark Fig. 4 from Zhong et al., 2018
whole organism lck expression decreased amount, abnormal WT + MO2-ezh2 control Fig. 9 from Zhong et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.