Morpholino

MO1-zbtb17

ID

ZDB-MRPHLNO-180123-1

Name

MO1-zbtb17

Previous Names

None

Target

Sequence

5' - ATGGAAAATCCATAACTGACTGTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-zbtb17

Expressed Gene	Anatomy	Figures
ccr9a	whole organism	Fig. 5 from Lawir et al., 2017
ccr9b	whole organism	Fig. 5 from Lawir et al., 2017
gh1	adenohypophysis whole organism	Fig. 2 from Lawir et al., 2017
rag1	thymus T cell whole organism	Fig. 2 from Lawir et al., 2017

Phenotype

Phenotype resulting from MO1-zbtb17

Phenotype	Fish	Figures
adenohypophysis gh1 expression decreased amount, abnormal	TU + MO1-zbtb17	Fig. 2 from Lawir et al., 2017
T cell differentiation decreased occurrence, abnormal	TU + MO1-zbtb17	Fig. 2 from Lawir et al., 2017
T cell migration decreased occurrence, abnormal	fr101Tg + MO1-zbtb17	Fig. 4 from Lawir et al., 2017
thymus lymphoid progenitor cell decreased amount, abnormal	fr101Tg + MO1-zbtb17	Fig. 4 from Lawir et al., 2017
thymus T cell rag1 expression decreased amount, abnormal	TU + MO1-zbtb17	Fig. 2 from Lawir et al., 2017
whole organism rag1 expression decreased amount, abnormal	TU + MO1-zbtb17	Fig. 2 from Lawir et al., 2017
whole organism ccr9b expression decreased amount, abnormal	TU + MO1-zbtb17	Fig. 5 from Lawir et al., 2017
whole organism gh1 expression decreased amount, abnormal	TU + MO1-zbtb17	Fig. 2 from Lawir et al., 2017
whole organism ccr9a expression decreased amount, abnormal	TU + MO1-zbtb17	Fig. 5 from Lawir et al., 2017

Phenotype of all Fish created by or utilizing MO1-zbtb17

Phenotype	Fish	Conditions	Figures
thymus T cell rag1 expression decreased amount, abnormal	TU + MO1-zbtb17	standard conditions	Fig. 2 from Lawir et al., 2017
whole organism ccr9b expression decreased amount, abnormal	TU + MO1-zbtb17	standard conditions	Fig. 5 from Lawir et al., 2017
whole organism ccr9a expression decreased amount, abnormal	TU + MO1-zbtb17	standard conditions	Fig. 5 from Lawir et al., 2017
T cell differentiation decreased occurrence, abnormal	TU + MO1-zbtb17	standard conditions	Fig. 2 from Lawir et al., 2017
whole organism gh1 expression decreased amount, abnormal	TU + MO1-zbtb17	standard conditions	Fig. 2 from Lawir et al., 2017
adenohypophysis gh1 expression decreased amount, abnormal	TU + MO1-zbtb17	standard conditions	Fig. 2 from Lawir et al., 2017
whole organism rag1 expression decreased amount, abnormal	TU + MO1-zbtb17	standard conditions	Fig. 2 from Lawir et al., 2017
thymus lymphoid progenitor cell decreased amount, abnormal	fr101Tg + MO1-zbtb17	standard conditions	Fig. 4 from Lawir et al., 2017
T cell migration decreased occurrence, abnormal	fr101Tg + MO1-zbtb17	standard conditions	Fig. 4 from Lawir et al., 2017

Citations