Morpholino

MO1-nup210

ID
ZDB-MRPHLNO-171107-1
Name
MO1-nup210
Previous Names
None
Target
Sequence
5' - CACGAGCAGACCGACCTTCTCCATA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nup210
Expressed Gene Anatomy Figures
myf5 Fig. 2 with image from Raices et al., 2017
myod1 Fig. 2 with image from Raices et al., 2017
pax3a Fig. 2 with image from Raices et al., 2017
Phenotype
Phenotype resulting from MO1-nup210
Phenotype Fish Figures
caudal fin curved, abnormal TL + MO1-nup210 Fig. 1 with image from Raices et al., 2017
heart edematous, abnormal TL + MO1-nup210 Fig. 1 with image from Raices et al., 2017
muscle disorganized, abnormal TL + MO1-nup210 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Raices et al., 2017
muscle cell detached from myoseptum, abnormal TL + MO1-nup210 Fig. 1 with image,  Fig. 2 with image from Raices et al., 2017
muscle cell structure, abnormal TL + MO1-nup210 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Raices et al., 2017
muscle cell undulate, abnormal TL + MO1-nup210 Fig. 1 with image from Raices et al., 2017
muscle cell skeletal muscle myofibril structure, abnormal TL + MO1-nup210 Fig. 1 with image,  Fig. 3 with image from Raices et al., 2017
myotome apoptotic process increased occurrence, abnormal TL + MO1-nup210 Fig. 3 with image from Raices et al., 2017
skeletal muscle fiber development decreased process quality, abnormal TL + MO1-nup210 Fig. 2 with image from Raices et al., 2017
somite decreased length, abnormal TL + MO1-nup210 Fig. 1 with image from Raices et al., 2017
somite decreased width, abnormal TL + MO1-nup210 Fig. 1 with image from Raices et al., 2017
somite U-shaped, abnormal TL + MO1-nup210 Fig. 1 with image,  Fig. 4 with image,  Fig. 5 with image from Raices et al., 2017
whole organism decreased length, abnormal TL + MO1-nup210 Fig. 1 with image from Raices et al., 2017
Phenotype of all Fish created by or utilizing MO1-nup210
Phenotype Fish Conditions Figures
muscle cell skeletal muscle myofibril structure, abnormal TL + MO1-nup210 control Fig. 1 with image,  Fig. 3 with image from Raices et al., 2017
muscle cell undulate, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
somite U-shaped, abnormal TL + MO1-nup210 control Fig. 1 with image,  Fig. 4 with image,  Fig. 5 with image from Raices et al., 2017
muscle cell detached from myoseptum, abnormal TL + MO1-nup210 control Fig. 1 with image,  Fig. 2 with image from Raices et al., 2017
heart edematous, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
skeletal muscle fiber development decreased process quality, abnormal TL + MO1-nup210 control Fig. 2 with image from Raices et al., 2017
somite decreased width, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
muscle disorganized, abnormal TL + MO1-nup210 control Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Raices et al., 2017
whole organism decreased length, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
somite decreased length, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
myotome apoptotic process increased occurrence, abnormal TL + MO1-nup210 control Fig. 3 with image from Raices et al., 2017
caudal fin curved, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
skeletal muscle fiber development decreased process quality, abnormal TL + MO1-nup210 chemical treatment by environment: Cyclopamine Fig. 2 with image from Raices et al., 2017
muscle cell structure, abnormal TL + MO1-nup210 control Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Raices et al., 2017
muscle cell structure, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
somite U-shaped, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
muscle disorganized, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
somite U-shaped, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
muscle disorganized, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
muscle cell structure, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.