Morpholino

MO1-cln3

ID
ZDB-MRPHLNO-170816-1
Name
MO1-cln3
Previous Names
None
Target
Sequence
5' - CATTGCGACTTTCACAGGAGAAATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cln3
No data available
Phenotype
Phenotype resulting from MO1-cln3
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
axon extension disrupted, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain morphology, abnormal TL + MO1-cln3 Fig. 3 with imageFig. 6 with image from Wager et al., 2016
brain astrocyte increased amount, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain axon aggregated, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain axon disorganized, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain cell apoptotic, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
brain lysosome hypertrophic, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
brain neuron decreased amount, abnormal knu3Tg + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain development disrupted, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
cranial nerve II decreased width, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
eye mitochondrion morphology, abnormal TL + MO1-cln3 Fig. 9 with image from Wager et al., 2016
forebrain apoptotic body increased amount, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
fourth ventricle increased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
hindbrain size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
larval locomotory behavior process quality, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
midbrain decreased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
neuron morphology, abnormal knu3Tg + MO1-cln3 Fig. 6 with image from Wager et al., 2016
optic tectum axon absent, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 + MO4-tp53 Fig. 4 from Wager et al., 2016
pericardium increased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
post-vent region curved, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
regulation of mitochondrial membrane potential disrupted, abnormal TL + MO1-cln3 Fig. 9 with image from Wager et al., 2016
retina decreased size, abnormal TL + MO1-cln3 Fig. 3 with imageFig. 7 with image from Wager et al., 2016
retina cell apoptotic, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
retina cell population proliferation disrupted, abnormal TL + MO1-cln3 Fig. 7 with image from Wager et al., 2016
spinal cord astrocyte increased amount, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
whole organism dead, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
whole organism decreased life span, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
whole organism lysosome increased size, abnormal TL + MO1-cln3 Fig. 9 with image from Wager et al., 2016
whole organism thigmotaxis disrupted, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
yolk increased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
Phenotype of all Fish created by or utilizing MO1-cln3
Phenotype Fish Conditions Figures
larval locomotory behavior process quality, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
whole organism dead, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
forebrain apoptotic body increased amount, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
brain morphology, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
yolk increased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
retina cell population proliferation disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 7 with image from Wager et al., 2016
axon extension disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
midbrain decreased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
retina cell apoptotic, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
fourth ventricle increased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
brain axon aggregated, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain cell apoptotic, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
brain development disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 4 from Wager et al., 2016
regulation of mitochondrial membrane potential disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 9 with image from Wager et al., 2016
brain lysosome hypertrophic, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
cranial nerve II decreased width, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
whole organism lysosome increased size, abnormal TL + MO1-cln3 standard conditions Fig. 9 with image from Wager et al., 2016
hindbrain size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
whole organism decreased life span, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
post-vent region curved, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
optic tectum axon absent, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain astrocyte increased amount, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain axon disorganized, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
whole organism thigmotaxis disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
pericardium increased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
retina decreased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with imageFig. 7 with image from Wager et al., 2016
eye mitochondrion morphology, abnormal TL + MO1-cln3 standard conditions Fig. 9 with image from Wager et al., 2016
apoptotic process increased occurrence, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
spinal cord astrocyte increased amount, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 + MO4-tp53 standard conditions Fig. 4 from Wager et al., 2016
brain morphology, abnormal knu3Tg + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
neuron morphology, abnormal knu3Tg + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain neuron decreased amount, abnormal knu3Tg + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
Citations