Morpholino

MO2-sec14l8

ID

ZDB-MRPHLNO-170718-2

Name

MO2-sec14l8

Previous Names

sec14l3-MO2 (1)

Target

sec14l8 (1)

Sequence

5' - ATGTCGCCACGAGTGCAGCAGAAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO, targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-sec14l8

No data available

Phenotype

Phenotype resulting from MO2-sec14l8

Phenotype	Fish	Figures
dorsal aorta attached to posterior cardinal vein, abnormal	s843Tg + MO2-sec14l8	Fig. 2 from Gong et al., 2019
dorsal aorta decreased diameter, abnormal	s843Tg + MO2-sec14l8	Fig. 3 from Gong et al., 2019
dorsal aorta decreased length, abnormal	s843Tg + MO2-sec14l8	Fig. 5 from Gong et al., 2019
dorsal aorta endothelial tube lumen extension decreased occurrence, abnormal	s843Tg + MO2-sec14l8	Fig. 3 from Gong et al., 2019
endothelial tube lumen extension decreased occurrence, abnormal	s843Tg + MO2-sec14l8	Fig. 2 from Gong et al., 2019
intersegmental vein morphology, abnormal	s843Tg + MO2-sec14l8	Fig. 2 from Gong et al., 2019
intersegmental vessel decreased length, abnormal	s843Tg + MO2-sec14l8	Fig. 5 from Gong et al., 2019
posterior cardinal vein decreased diameter, abnormal	s843Tg + MO2-sec14l8	Fig. 3 from Gong et al., 2019
posterior cardinal vein decreased length, abnormal	s843Tg + MO2-sec14l8	Fig. 5 from Gong et al., 2019
posterior cardinal vein endothelial tube lumen extension decreased occurrence, abnormal	s843Tg + MO2-sec14l8	Fig. 3 from Gong et al., 2019

Phenotype of all Fish created by or utilizing MO2-sec14l8

Phenotype	Fish	Conditions	Figures
dorsal aorta decreased length, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 5 from Gong et al., 2019
intersegmental vessel decreased length, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 5 from Gong et al., 2019
posterior cardinal vein decreased length, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 5 from Gong et al., 2019
posterior cardinal vein decreased diameter, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 3 from Gong et al., 2019
dorsal aorta endothelial tube lumen extension decreased occurrence, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 3 from Gong et al., 2019
posterior cardinal vein endothelial tube lumen extension decreased occurrence, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 3 from Gong et al., 2019
dorsal aorta decreased diameter, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 3 from Gong et al., 2019
dorsal aorta attached to posterior cardinal vein, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 2 from Gong et al., 2019
endothelial tube lumen extension decreased occurrence, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 2 from Gong et al., 2019
intersegmental vein morphology, abnormal	s843Tg + MO2-sec14l8	standard conditions	Fig. 2 from Gong et al., 2019
endothelial tube lumen extension decreased occurrence, abnormal	tp53^zdf1/zdf1; s843Tg + MO2-sec14l8	standard conditions	Fig. 2 from Gong et al., 2019
dorsal aorta attached to posterior cardinal vein, abnormal	tp53^zdf1/zdf1; s843Tg + MO2-sec14l8	standard conditions	Fig. 2 from Gong et al., 2019

Citations