Morpholino

MO3-add3a

ID

ZDB-MRPHLNO-170623-1

Name

MO3-add3a

Previous Names

add3a-IE3/6 (1)

Target

add3a (1)

Sequence

5' - AACGCCTGAAAGAGAATGTGAGTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO. This morpholino does not match the sequence in ensembl. there is a single nucleotide change A to T at the second to last position.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-add3a

No data available

Phenotype

Phenotype resulting from MO3-add3a

No data available

Phenotype of all Fish created by or utilizing MO3-add3a

Phenotype	Fish	Conditions	Figures
liver morphogenesis decreased occurrence, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 2 from Tang et al., 2016
hepaticobiliary system development decreased occurrence, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 2 , Fig. 3 from Tang et al., 2016
liver morphology, ameliorated	TL + MO2-add3a + MO3-add3a	chemical treatment by environment: Cyclopamine	Fig. 3 from Tang et al., 2016
liver functionality, ameliorated	TL + MO2-add3a + MO3-add3a	chemical treatment by environment: Cyclopamine	Fig. 3 from Tang et al., 2016
hepaticobiliary system development occurrence, ameliorated	TL + MO2-add3a + MO3-add3a	chemical treatment by environment: Cyclopamine	Fig. 3 from Tang et al., 2016
liver has fewer parts of type intrahepatic bile duct, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 2 , Fig. 3 from Tang et al., 2016
intrahepatic bile duct decreased length, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 2 , Fig. 3 from Tang et al., 2016
liver has number of intrahepatic bile duct, ameliorated	TL + MO2-add3a + MO3-add3a	chemical treatment by environment: Cyclopamine	Fig. 3 from Tang et al., 2016
whole organism ptch1 expression increased amount, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 3 from Tang et al., 2016
whole organism ccnd1 expression increased amount, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 3 from Tang et al., 2016
liver malformed, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 2 , Fig. 3 from Tang et al., 2016
whole organism gli2a expression increased amount, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 3 from Tang et al., 2016
liver decreased functionality, abnormal	TL + MO2-add3a + MO3-add3a	standard conditions	Fig. 3 from Tang et al., 2016
intrahepatic bile duct length, ameliorated	TL + MO2-add3a + MO3-add3a	chemical treatment by environment: Cyclopamine	Fig. 3 from Tang et al., 2016
liver decreased functionality, exacerbated	TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a	standard conditions	Fig. 4 from Tang et al., 2016
intrahepatic bile duct decreased length, exacerbated	TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a	standard conditions	Fig. 4 from Tang et al., 2016
liver has fewer parts of type intrahepatic bile duct, exacerbated	TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a	standard conditions	Fig. 4 from Tang et al., 2016
hepaticobiliary system development decreased occurrence, exacerbated	TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a	standard conditions	Fig. 4 from Tang et al., 2016

Citations