Morpholino

MO3-zeb1a

ID

ZDB-MRPHLNO-170327-2

Name

MO3-zeb1a

Previous Names

None

Target

Sequence

5' - CTGTGATTGTTTGTTTACTCACCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-zeb1a

Expressed Gene	Anatomy	Figures
cdh1	mesoderm	Fig. 4 from Gays et al., 2017
oclna	mesoderm	Fig. 4 from Gays et al., 2017

Phenotype

Phenotype resulting from MO3-zeb1a

Phenotype	Fish	Figures
gut anatomical region EGFP expression spatial pattern, abnormal	pd24Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017
intestine smooth muscle ab1-tagln labeling decreased amount, abnormal	uto5Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017
intestine smooth muscle mCherry expression decreased amount, abnormal	uto5Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017
intestine smooth muscle cell decreased amount, abnormal	s854Tg; uto5Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017
lateral plate mesoderm tissue migration decreased occurrence, abnormal	pd24Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017
lateral plate mesoderm tissue migration decreased process quality, abnormal	pd24Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017
mesoderm oclna expression decreased amount, abnormal	pd24Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017
mesoderm cdh1 expression decreased amount, abnormal	pd24Tg + MO3-zeb1a	Fig. 4 from Gays et al., 2017

Phenotype of all Fish created by or utilizing MO3-zeb1a

Phenotype	Fish	Conditions	Figures
mesoderm oclna expression decreased amount, abnormal	pd24Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017
lateral plate mesoderm tissue migration decreased occurrence, abnormal	pd24Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017
gut anatomical region EGFP expression spatial pattern, abnormal	pd24Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017
mesoderm cdh1 expression decreased amount, abnormal	pd24Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017
lateral plate mesoderm tissue migration decreased process quality, abnormal	pd24Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017
intestine smooth muscle ab1-tagln labeling decreased amount, abnormal	uto5Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017
intestine smooth muscle mCherry expression decreased amount, abnormal	uto5Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017
intestine smooth muscle cell decreased amount, abnormal	s854Tg; uto5Tg + MO3-zeb1a	control	Fig. 4 from Gays et al., 2017

Citations