Morpholino

MO2-ephb4b

ID

ZDB-MRPHLNO-161004-2

Name

MO2-ephb4b

Previous Names

None

Target

ephb4b (1)

Sequence

5' - AATCCAGCAAACACGATCCATCTCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ephb4b

Expressed Gene	Anatomy	Figures
foxa3	intestine liver pancreas	Fig. 2 from Zhang et al., 2016
myl7	heart	Fig. 2 from Zhang et al., 2016
sox17	forerunner cell group	Fig. 3 from Zhang et al., 2016
spaw	lateral plate mesoderm right side	Fig. 2 from Zhang et al., 2016

Phenotype

Phenotype resulting from MO2-ephb4b

Phenotype	Fish	Figures
forerunner cell group dispersed, abnormal	s870Tg + MO2-ephb4b	Fig. 3 from Zhang et al., 2016
forerunner cell group mislocalised anteriorly, abnormal	s870Tg + MO2-ephb4b	Fig. 3 from Zhang et al., 2016
forerunner cell group mislocalised ventrally, abnormal	s870Tg + MO2-ephb4b	Fig. 3 from Zhang et al., 2016
heart heart looping decreased occurrence, abnormal	TU + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
Kupffer's vesicle decreased volume, abnormal	s870Tg + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal	TU + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
Kupffer's vesicle irregularly shaped, abnormal	s870Tg + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
Kupffer's vesicle development decreased process quality, abnormal	s870Tg + MO2-ephb4b	Fig. 2 , Fig. 3 from Zhang et al., 2016
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal	TU + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
lateral plate mesoderm left side spaw expression absent, abnormal	TU + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal	TU + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
liver determination of liver left/right asymmetry decreased occurrence, abnormal	TU + MO2-ephb4b	Fig. 2 from Zhang et al., 2016
pancreas determination of pancreatic left/right asymmetry decreased occurrence, abnormal	TU + MO2-ephb4b	Fig. 2 from Zhang et al., 2016

Phenotype of all Fish created by or utilizing MO2-ephb4b

Phenotype	Fish	Conditions	Figures
lateral plate mesoderm left side spaw expression absent, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
heart heart looping decreased occurrence, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
forerunner cell group dispersed, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 3 from Zhang et al., 2016
pancreas determination of pancreatic left/right asymmetry decreased occurrence, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
liver determination of liver left/right asymmetry decreased occurrence, abnormal	TU + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
Kupffer's vesicle decreased volume, abnormal	s870Tg + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
forerunner cell group mislocalised anteriorly, abnormal	s870Tg + MO2-ephb4b	standard conditions	Fig. 3 from Zhang et al., 2016
forerunner cell group dispersed, abnormal	s870Tg + MO2-ephb4b	standard conditions	Fig. 3 from Zhang et al., 2016
Kupffer's vesicle irregularly shaped, abnormal	s870Tg + MO2-ephb4b	standard conditions	Fig. 2 from Zhang et al., 2016
forerunner cell group mislocalised ventrally, abnormal	s870Tg + MO2-ephb4b	standard conditions	Fig. 3 from Zhang et al., 2016
Kupffer's vesicle development decreased process quality, abnormal	s870Tg + MO2-ephb4b	standard conditions	Fig. 2 , Fig. 3 from Zhang et al., 2016

Citations