Morpholino

MO2-fhl1b

ID
ZDB-MRPHLNO-160413-8
Name
MO2-fhl1b
Previous Names
None
Target
Sequence
5' - CCCGCGAAAAGCTGTGAGAAATAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fhl1b
No data available
Phenotype
Phenotype resulting from MO2-fhl1b
No data available
Phenotype of all Fish created by or utilizing MO2-fhl1b
Phenotype Fish Conditions Figures
pancreas primordium pdx1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 5 with image from Xu et al., 2016
endoderm pdx1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 5 with image from Xu et al., 2016
primary islet neurod1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 6 with image from Xu et al., 2016
digestive system duct pdx1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 6 with image from Xu et al., 2016
insulin secreting cell ab2-isl labeling increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image,  Fig. S13 with image from Xu et al., 2016
posterior pancreatic bud hhex expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image,  Fig. S13 with image from Xu et al., 2016
somatostatin secreting cell increased amount, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
primary islet pdx1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 6 with image from Xu et al., 2016
posterior pancreatic bud pdx1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image,  Fig. S13 with image from Xu et al., 2016
liver development decreased occurrence, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
intestine pdx1 expression decreased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image,  Fig. S13 with image from Xu et al., 2016
pancreas induction increased occurrence, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
liver hhex expression decreased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image,  Fig. S13 with image from Xu et al., 2016
digestive system duct neurod1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 6 with image from Xu et al., 2016
endocrine pancreas pancreas induction increased occurrence, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
pancreas primordium neurod1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 5 with image from Xu et al., 2016
insulin secreting cell increased amount, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
endoderm neurod1 expression increased distribution, abnormal WT + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 5 with image from Xu et al., 2016
endoderm lateral region EGFP expression mislocalised, abnormal nl1Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 5 with image from Xu et al., 2016
insulin secreting cell ab2-isl labeling increased distribution, abnormal s870Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
liver development decreased occurrence, abnormal s870Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
pancreas induction increased occurrence, abnormal s870Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
insulin secreting cell increased amount, abnormal s870Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
pancreatic bud endocrine cell GFP expression increased distribution, abnormal ulg515Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
endocrine pancreas pancreas induction increased occurrence, abnormal ulg515Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
pancreas endocrine cell increased amount, abnormal ulg515Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
posterior pancreatic bud ab2-isl labeling increased distribution, abnormal zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
liver development decreased occurrence, abnormal zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
insulin secreting cell GFP expression increased distribution, abnormal zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
pancreas induction increased occurrence, abnormal zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
primary islet ab2-isl labeling increased distribution, abnormal zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
insulin secreting cell increased amount, abnormal zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 2 with image from Xu et al., 2016
insulin secreting cell DsRed expression increased distribution, abnormal m1018Tg; zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
insulin secreting cell GFP expression increased distribution, abnormal m1018Tg; zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
insulin secreting cell increased amount, abnormal m1018Tg; zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
endocrine pancreas pancreas induction increased occurrence, abnormal m1018Tg; zf5Tg + MO1-fhl1b + MO2-fhl1b standard conditions Fig. 3 with image from Xu et al., 2016
posterior pancreatic bud hhex expression increased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
posterior pancreatic bud pdx1 expression increased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
intestine pdx1 expression decreased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
intestine hhex expression decreased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
insulin secreting cell ab2-isl labeling spatial pattern, ameliorated fr13Tg + MO1-fhl1b + MO2-fhl1b heat shock Fig. S13 with image from Xu et al., 2016
insulin secreting cell ab2-isl labeling increased distribution, abnormal fr13Tg + MO1-fhl1b + MO2-fhl1b heat shock Fig. S13 with image from Xu et al., 2016
insulating cell pancreas regeneration increased rate, abnormal jh6Tg; s892Tg + MO1-fhl1b + MO2-fhl1b chemical ablation: insulin secreting cell, chemical treatment: metronidazole Fig. 6 with image from Xu et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.