Morpholino

MO1-myo18ab

ID
ZDB-MRPHLNO-151217-3
Name
MO1-myo18ab
Previous Names
  • exon 7 (1)
Target
Sequence
5' - TGAGTTCACCTGAGTGTGCTGTCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myo18ab
Expressed Gene Anatomy Figures
dmd Fig. 3 from Cao et al., 2014
myf5 Fig. 5 from Cao et al., 2014
myod1 Fig. 5 from Cao et al., 2014
Phenotype
Phenotype resulting from MO1-myo18ab
Phenotype Fish Figures
eye decreased size, abnormal WT + MO1-myo18ab Fig. 2 from Cao et al., 2014
fast muscle cell disorganized, abnormal WT + MO1-myo18ab Fig. 5 with image from Cao et al., 2016
fast muscle cell ab-f310 labeling spatial pattern, abnormal WT + MO1-myo18ab Fig. 5 with image from Cao et al., 2016
head decreased size, abnormal WT + MO1-myo18ab Fig. 2 from Cao et al., 2014
muscle cell detached from myotome, abnormal WT + MO1-myo18ab Fig. 3 from Cao et al., 2014
muscle cell disorganized, abnormal WT + MO1-myo18ab Fig. 4 with image,  Fig. 5 with image from Cao et al., 2016
Fig. 2,  Fig. 3 from Cao et al., 2014
muscle cell misaligned with somite, abnormal WT + MO1-myo18ab Fig. 3 from Cao et al., 2014
notochord morphology, abnormal WT + MO1-myo18ab Fig. 5 from Cao et al., 2014
slow muscle cell disorganized, abnormal WT + MO1-myo18ab Fig. 4 with image from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal WT + MO1-myo18ab Fig. 4 with image from Cao et al., 2016
somite patchy, abnormal WT + MO1-myo18ab Fig. 3 from Cao et al., 2014
somite border irregular spatial pattern, abnormal WT + MO1-myo18ab Fig. 2 from Cao et al., 2014
somite border ab1-dag1 labeling spatial pattern, abnormal WT + MO1-myo18ab Fig. 3 from Cao et al., 2014
somite border ab1-dmd labeling spatial pattern, abnormal WT + MO1-myo18ab Fig. 4 with image from Cao et al., 2016
somite border dmd expression spatial pattern, abnormal WT + MO1-myo18ab Fig. 3 from Cao et al., 2014
swimming behavior process quality, abnormal WT + MO1-myo18ab Fig. S2 from Cao et al., 2014
thigmotaxis disrupted, abnormal WT + MO1-myo18ab Fig. S2 from Cao et al., 2014
trunk bent, abnormal WT + MO1-myo18ab Fig. 2 from Cao et al., 2014
vertical myoseptum morphology, abnormal WT + MO1-myo18ab Fig. 4 with image from Cao et al., 2016
whole organism anterior-posterior axis shortened, abnormal WT + MO1-myo18ab Fig. 2 from Cao et al., 2014
Phenotype of all Fish created by or utilizing MO1-myo18ab
Phenotype Fish Conditions Figures
somite border ab1-dag1 labeling spatial pattern, abnormal WT + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
trunk bent, abnormal WT + MO1-myo18ab standard conditions Fig. 2 from Cao et al., 2014
muscle cell misaligned with somite, abnormal WT + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
somite border irregular spatial pattern, abnormal WT + MO1-myo18ab standard conditions Fig. 2 from Cao et al., 2014
somite patchy, abnormal WT + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
muscle cell disorganized, abnormal WT + MO1-myo18ab standard conditions Fig. 4 with image,  Fig. 5 with image from Cao et al., 2016
Fig. 2,  Fig. 3 from Cao et al., 2014
fast muscle cell disorganized, abnormal WT + MO1-myo18ab standard conditions Fig. 5 with image from Cao et al., 2016
whole organism anterior-posterior axis shortened, abnormal WT + MO1-myo18ab standard conditions Fig. 2 from Cao et al., 2014
head decreased size, abnormal WT + MO1-myo18ab standard conditions Fig. 2 from Cao et al., 2014
fast muscle cell ab-f310 labeling spatial pattern, abnormal WT + MO1-myo18ab standard conditions Fig. 5 with image from Cao et al., 2016
notochord morphology, abnormal WT + MO1-myo18ab standard conditions Fig. 5 from Cao et al., 2014
swimming behavior process quality, abnormal WT + MO1-myo18ab standard conditions Fig. S2 from Cao et al., 2014
muscle cell detached from myotome, abnormal WT + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
somite border dmd expression spatial pattern, abnormal WT + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
slow muscle cell disorganized, abnormal WT + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
eye decreased size, abnormal WT + MO1-myo18ab standard conditions Fig. 2 from Cao et al., 2014
slow muscle cell ab-f59 labeling spatial pattern, abnormal WT + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
thigmotaxis disrupted, abnormal WT + MO1-myo18ab standard conditions Fig. S2 from Cao et al., 2014
vertical myoseptum morphology, abnormal WT + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal WT + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal WT + MO1-arhgef28a + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
vertical myoseptum morphology, exacerbated WT + MO1-arhgef28a + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal WT + MO1-arhgef28a + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
muscle cell disorganized, exacerbated WT + MO1-arhgef28a + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
slow muscle cell disorganized, exacerbated WT + MO1-arhgef28a + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal WT + MO1-blzf1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal WT + MO1-blzf1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
muscle cell disorganized, exacerbated WT + MO1-blzf1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
slow muscle cell disorganized, exacerbated WT + MO1-blzf1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
vertical myoseptum morphology, exacerbated WT + MO1-blzf1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal WT + MO1-lurap1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal WT + MO1-lurap1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
muscle cell disorganized, exacerbated WT + MO1-lurap1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
slow muscle cell disorganized, exacerbated WT + MO1-lurap1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
vertical myoseptum morphology, exacerbated WT + MO1-lurap1 + MO1-myo18ab standard conditions Fig. 4 with image from Cao et al., 2016
muscle cell detached from somite border, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 4 from Cao et al., 2014
muscle cell disorganized, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 4 from Cao et al., 2014
myotome anatomical boundary ab-f310 labeling spatial pattern, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 4 from Cao et al., 2014
myoblast cell-matrix adhesion arrested, abnormal WT + MO1-myo18aa + MO1-myo18ab primary cell culture: somite Fig. 6 with image from Cao et al., 2016
somite border dmd expression spatial pattern, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
myoblast Golgi apparatus morphology, abnormal WT + MO1-myo18aa + MO1-myo18ab primary cell culture: somite Fig. 7 with image from Cao et al., 2016
somite border ab1-dag1 labeling spatial pattern, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
myoblast cell-matrix adhesion decreased occurrence, abnormal WT + MO1-myo18aa + MO1-myo18ab primary cell culture: somite Fig. 6 with image from Cao et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.