Morpholino

MO1-gdap1

ID
ZDB-MRPHLNO-151207-1
Name
MO1-gdap1
Previous Names
None
Target
Sequence
5' - CCTTGCATCTCAAATGTTTACCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gdap1
No data available
Phenotype
Phenotype resulting from MO1-gdap1
Phenotype of all Fish created by or utilizing MO1-gdap1
Phenotype Fish Conditions Figures
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon absent, abnormal AB/EKW + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-abhd12 + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-abhd12 + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-abhd12 + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-abhd12 + MO1-gdap1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
sensory neuron neuron projection hypoplastic, abnormal mitfaw2/w2; zf154Tg + MO1-gdap1 standard conditions Fig. 4 from Eijkenboom et al., 2019
neuron projection development disrupted, abnormal mitfaw2/w2; zf154Tg + MO1-gdap1 standard conditions Fig. 4 from Eijkenboom et al., 2019
post-vent region shape, abnormal mitfaw2/w2; zf154Tg + MO1-gdap1 standard conditions Fig. 2 from Eijkenboom et al., 2019
swimming behavior process quality, abnormal mitfaw2/w2; zf154Tg + MO1-gdap1 heat exposure Fig. 5 from Eijkenboom et al., 2019
Citations