Morpholino

MO2-wnt9b

ID
ZDB-MRPHLNO-151125-3
Name
MO2-wnt9b
Previous Names
None
Target
Sequence
5' - ACCTGTAAGCCTAACGAAAACACAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt9b
Phenotype
Phenotype resulting from MO2-wnt9b
Phenotype Fish Figures
brain wnt3a expression increased distribution, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
ceratobranchial cartilage decreased size, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
ceratohyal cartilage inverted, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
cranium decreased length, abnormal AB + MO2-wnt9b Fig. 2 with image from Jackson et al., 2015
cranium anterior region decreased length, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
ethmoid cartilage sox9a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
ethmoid cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
head anterior region flattened, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
mandibular arch skeleton malformed, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
Meckel's cartilage malformed, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
palatoquadrate arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
palatoquadrate arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
palatoquadrate cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
palatoquadrate cartilage decreased length, abnormal AB + MO2-wnt9b Fig. 2 with image from Jackson et al., 2015
palatoquadrate cartilage fused with Meckel's cartilage, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
pectoral fin bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
pharyngeal arch edn1 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 4 with image from Jackson et al., 2015
pharyngeal arch wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 6 with imageFig. 7 with image from Jackson et al., 2015
pharyngeal arch jag1b expression increased distribution, abnormal AB + MO2-wnt9b Fig. 4 with image from Jackson et al., 2015
pharyngeal arch 1 sox9a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
pharyngeal arch 1 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 5 with image from Jackson et al., 2015
pharyngeal arch 3-7 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 5 with image from Jackson et al., 2015
polster frzb expression increased amount, abnormal AB + MO2-wnt9b Fig. 9 with image from Jackson et al., 2015
polster frzb expression increased distribution, abnormal AB + MO2-wnt9b Fig. 9 with image from Jackson et al., 2015
tail bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
tail bud wnt5b expression increased distribution, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
whole organism msx1a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism wnt9a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism axin2 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism tbx22 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism wnt3a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism dlx2a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism edn1 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism has fewer parts of type ceratobranchial cartilage, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
whole organism lacks all parts of type swim bladder, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
Phenotype of all Fish created by or utilizing MO2-wnt9b
Phenotype Fish Conditions Figures
palatoquadrate arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
tail bud wnt5b expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
cranium anterior region decreased length, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
palatoquadrate cartilage decreased length, abnormal AB + MO2-wnt9b standard conditions Fig. 2 with image from Jackson et al., 2015
ceratohyal cartilage inverted, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
ethmoid cartilage sox9a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
pharyngeal arch 3-7 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 5 with image from Jackson et al., 2015
whole organism has fewer parts of type ceratobranchial cartilage, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
pharyngeal arch 1 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 5 with image from Jackson et al., 2015
polster frzb expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 9 with image from Jackson et al., 2015
polster frzb expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 9 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
whole organism edn1 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
brain wnt3a expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
pharyngeal arch edn1 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 4 with image from Jackson et al., 2015
head anterior region flattened, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
whole organism wnt3a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
pectoral fin bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
pharyngeal arch wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with imageFig. 7 with image from Jackson et al., 2015
palatoquadrate cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
whole organism lacks all parts of type swim bladder, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
whole organism wnt9a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
ceratobranchial cartilage decreased size, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
cranium decreased length, abnormal AB + MO2-wnt9b standard conditions Fig. 2 with image from Jackson et al., 2015
pharyngeal arch jag1b expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 4 with image from Jackson et al., 2015
whole organism axin2 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
palatoquadrate cartilage fused with Meckel's cartilage, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
whole organism wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
whole organism msx1a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
mandibular arch skeleton malformed, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
tail bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
palatoquadrate arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
ethmoid cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
Meckel's cartilage malformed, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
pharyngeal arch 1 sox9a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
whole organism tbx22 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
whole organism dlx2a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
myocardium zn-8 labeling spatial pattern, abnormal ci1Tg/ci1Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 5. with image from Paolini et al., 2023
endocardium EGFP expression spatial pattern, abnormal ci1Tg/ci1Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 1. with imageFig. 5. with image from Paolini et al., 2023
cardiac chamber morphogenesis decreased process quality, abnormal el83Tg/el83Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 2. with image from Paolini et al., 2023
myocardial precursor EGFP expression spatial pattern, abnormal el83Tg/el83Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 1. with image from Paolini et al., 2023
heart primordium cardiac muscle cell EGFP expression spatial pattern, abnormal el83Tg/el83Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 2. with image from Paolini et al., 2023
myocardium EGFP expression spatial pattern, abnormal el83Tg/el83Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 1. with image from Paolini et al., 2023
whole organism myl7 expression decreased amount, abnormal pbb48Tg/pbb48Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 5. with image from Paolini et al., 2023
whole organism myh7 expression decreased amount, abnormal pbb48Tg/pbb48Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 5. with image from Paolini et al., 2023
endocardium EGFP expression spatial pattern, abnormal npas4lm378/m378; ci1Tg/ci1Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 5. with image from Paolini et al., 2023
myocardium zn-8 labeling spatial pattern, abnormal npas4lm378/m378; ci1Tg/ci1Tg + MO2-wnt9b + MO3-wnt9a standard conditions Fig. 5. with image from Paolini et al., 2023
Citations