Morpholino

MO1-ddx3xb

ID

ZDB-MRPHLNO-151109-9

Name

MO1-ddx3xb

Previous Names

Target

Sequence

5' - TGAGGAACAGAAACTCACTTCCAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ddx3xb

No data available

Phenotype

Phenotype resulting from MO1-ddx3xb

Phenotype	Fish	Figures
brain decreased size, abnormal	WT + MO1-ddx3xb	Fig. 4, Fig. S7 from Fitzgerald et al., 2015
eye decreased size, abnormal	WT + MO1-ddx3xb	Fig. S7 from Fitzgerald et al., 2015
eye morphology, abnormal	WT + MO1-ddx3xb	Fig. S7 from Fitzgerald et al., 2015
head decreased size, abnormal	WT + MO1-ddx3xb	Fig. 4, Fig. S7 from Fitzgerald et al., 2015
pericardium edematous, abnormal	WT + MO1-ddx3xb	Fig. S7 from Fitzgerald et al., 2015
trunk curved ventral, abnormal	WT + MO1-ddx3xb	Fig. S7 from Fitzgerald et al., 2015
whole organism decreased size, abnormal	WT + MO1-ddx3xb	Fig. S7 from Fitzgerald et al., 2015
whole organism anatomical axis decreased length, abnormal	WT + MO1-ddx3xb	Fig. S7 from Fitzgerald et al., 2015

Phenotype of all Fish created by or utilizing MO1-ddx3xb

Phenotype	Fish	Conditions	Figures
brain decreased size, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. 4, Fig. S7 from Fitzgerald et al., 2015
pericardium edematous, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. S7 from Fitzgerald et al., 2015
whole organism decreased size, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. S7 from Fitzgerald et al., 2015
trunk curved ventral, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. S7 from Fitzgerald et al., 2015
eye decreased size, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. S7 from Fitzgerald et al., 2015
whole organism anatomical axis decreased length, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. S7 from Fitzgerald et al., 2015
head decreased size, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. 4, Fig. S7 from Fitzgerald et al., 2015
eye morphology, abnormal	WT + MO1-ddx3xb	standard conditions	Fig. S7 from Fitzgerald et al., 2015
caudal fin bent, abnormal	WT + MO1-ddx3xa + MO1-ddx3xb	standard conditions	Fig. 6 from Ku et al., 2018
neutrophil chemotaxis decreased occurrence, abnormal	zf2197Tg + MO1-ddx3xa + MO1-ddx3xb	transection: caudal fin	Fig. 7 from Ku et al., 2018
neutrophil chemotaxis decreased process quality, abnormal	zf2197Tg + MO1-ddx3xa + MO1-ddx3xb	transection: caudal fin	Fig. 7 from Ku et al., 2018

Citations