Morpholino

MO1-atg7

ID
ZDB-MRPHLNO-151021-3
Name
MO1-atg7
Previous Names
None
Target
Sequence
5' - AGCTTCAGACTGGATTCCGCCATCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atg7
Expressed Gene Anatomy Figures
atg5 Fig. 1 from Lee et al., 2014
bmp4 Fig. 4 from Lee et al., 2014
dbx1b Fig. S7 from Lee et al., 2014
eed Fig. S7 from Lee et al., 2014
her15.1 Fig. S7 from Lee et al., 2014
hoxb2a Fig. S7 from Lee et al., 2014
msx3 Fig. S7 from Lee et al., 2014
myl7 Fig. 4 from Lee et al., 2014
mynn Fig. S7 from Lee et al., 2014
notch1b Fig. 4 from Lee et al., 2014
tbx2b Fig. 5 from Lee et al., 2014
tbx5a Fig. 5 from Lee et al., 2014
vcana Fig. 4 from Lee et al., 2014
znfl2a Fig. S7 from Lee et al., 2014
Phenotype
Phenotype resulting from MO1-atg7
Phenotype Fish Figures
atrioventricular canal tbx2b expression increased distribution, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
atrioventricular canal tbx2b expression mislocalised, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
atrium tbx2b expression increased distribution, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
atrium tbx2b expression mislocalised, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
autophagosome assembly disrupted, abnormal AB + MO1-atg7 Fig. 1 from Lee et al., 2014
cardiac ventricle tbx2b expression increased distribution, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
cardiac ventricle bmp4 expression mislocalised, abnormal AB + MO1-atg7 Fig. 4 from Lee et al., 2014
cardiac ventricle vcana expression mislocalised, abnormal AB + MO1-atg7 Fig. 4 from Lee et al., 2014
cardiac ventricle tbx2b expression mislocalised, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
cardiac ventricle notch1b expression mislocalised, abnormal AB + MO1-atg7 Fig. 4 from Lee et al., 2014
eye decreased size, abnormal AB + MO1-atg7 Fig. 2 from Lee et al., 2014
head decreased size, abnormal AB + MO1-atg7 Fig. 2 from Lee et al., 2014
heart dbx1b expression increased amount, abnormal AB + MO1-atg7 Fig. S7 from Lee et al., 2014
heart msx3 expression increased amount, abnormal AB + MO1-atg7 Fig. S7 from Lee et al., 2014
heart mynn expression increased amount, abnormal AB + MO1-atg7 Fig. S7 from Lee et al., 2014
heart znfl2a expression increased amount, abnormal AB + MO1-atg7 Fig. S7 from Lee et al., 2014
heart her15.1 expression increased amount, abnormal AB + MO1-atg7 Fig. S7 from Lee et al., 2014
heart eed expression increased amount, abnormal AB + MO1-atg7 Fig. S7 from Lee et al., 2014
heart hoxb2a expression increased amount, abnormal AB + MO1-atg7 Fig. S7 from Lee et al., 2014
heart tbx5a expression increased distribution, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
heart tbx5a expression mislocalised, abnormal AB + MO1-atg7 Fig. 5 from Lee et al., 2014
heart structure, abnormal AB + MO1-atg7 Fig. S1 from Lee et al., 2014
heart looping disrupted, abnormal AB + MO1-atg7 Fig. S1 from Lee et al., 2014
heart looping process quality, abnormal AB + MO1-atg7 Fig. 4 from Lee et al., 2014
heart tube linear, abnormal AB + MO1-atg7 Fig. 4 from Lee et al., 2014
pericardium edematous, abnormal AB + MO1-atg7 Fig. 2 from Lee et al., 2014
post-vent region cell death increased occurrence, abnormal AB + MO1-atg7 Fig. 2 from Lee et al., 2014
whole organism bent, abnormal AB + MO1-atg7 Fig. 2 from Lee et al., 2014
whole organism atg5 expression decreased amount, abnormal AB + MO1-atg7 Fig. 1 from Lee et al., 2014
whole organism viability, abnormal AB + MO1-atg7 Fig. S4 from Lee et al., 2014
Phenotype of all Fish created by or utilizing MO1-atg7
Phenotype Fish Conditions Figures
whole organism atg5 expression decreased amount, abnormal AB + MO1-atg7 control Fig. 1 from Lee et al., 2014
heart mynn expression increased amount, abnormal AB + MO1-atg7 standard conditions Fig. S7 from Lee et al., 2014
heart dbx1b expression increased amount, abnormal AB + MO1-atg7 standard conditions Fig. S7 from Lee et al., 2014
heart looping process quality, abnormal AB + MO1-atg7 standard conditions Fig. 4 from Lee et al., 2014
atrioventricular canal tbx2b expression increased distribution, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
heart hoxb2a expression increased amount, abnormal AB + MO1-atg7 standard conditions Fig. S7 from Lee et al., 2014
eye decreased size, abnormal AB + MO1-atg7 standard conditions Fig. 2 from Lee et al., 2014
cardiac ventricle bmp4 expression mislocalised, abnormal AB + MO1-atg7 standard conditions Fig. 4 from Lee et al., 2014
heart tbx5a expression increased distribution, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
heart her15.1 expression increased amount, abnormal AB + MO1-atg7 standard conditions Fig. S7 from Lee et al., 2014
atrioventricular canal tbx2b expression mislocalised, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
heart tube linear, abnormal AB + MO1-atg7 standard conditions Fig. 4 from Lee et al., 2014
heart znfl2a expression increased amount, abnormal AB + MO1-atg7 standard conditions Fig. S7 from Lee et al., 2014
heart msx3 expression increased amount, abnormal AB + MO1-atg7 standard conditions Fig. S7 from Lee et al., 2014
autophagosome assembly disrupted, abnormal AB + MO1-atg7 control Fig. 1 from Lee et al., 2014
cardiac ventricle notch1b expression mislocalised, abnormal AB + MO1-atg7 standard conditions Fig. 4 from Lee et al., 2014
whole organism bent, abnormal AB + MO1-atg7 standard conditions Fig. 2 from Lee et al., 2014
heart eed expression increased amount, abnormal AB + MO1-atg7 standard conditions Fig. S7 from Lee et al., 2014
cardiac ventricle tbx2b expression mislocalised, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
whole organism viability, abnormal AB + MO1-atg7 standard conditions Fig. S4 from Lee et al., 2014
head decreased size, abnormal AB + MO1-atg7 standard conditions Fig. 2 from Lee et al., 2014
heart structure, abnormal AB + MO1-atg7 standard conditions Fig. S1 from Lee et al., 2014
pericardium edematous, abnormal AB + MO1-atg7 standard conditions Fig. 2 from Lee et al., 2014
cardiac ventricle vcana expression mislocalised, abnormal AB + MO1-atg7 standard conditions Fig. 4 from Lee et al., 2014
post-vent region cell death increased occurrence, abnormal AB + MO1-atg7 standard conditions Fig. 2 from Lee et al., 2014
atrium tbx2b expression increased distribution, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
cardiac ventricle tbx2b expression increased distribution, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
heart tbx5a expression mislocalised, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
heart looping disrupted, abnormal AB + MO1-atg7 standard conditions Fig. S1 from Lee et al., 2014
atrium tbx2b expression mislocalised, abnormal AB + MO1-atg7 standard conditions Fig. 5 from Lee et al., 2014
whole organism cell death increased occurrence, abnormal tp53zdf1/zdf1 + MO1-atg7 standard conditions Fig. S3 from Lee et al., 2014
heart physical object quality, abnormal tp53zdf1/zdf1 + MO1-atg7 standard conditions Fig. S3 from Lee et al., 2014
whole organism bent, abnormal tp53zdf1/zdf1 + MO1-atg7 standard conditions Fig. S3 from Lee et al., 2014
head decreased size, abnormal tp53zdf1/zdf1 + MO1-atg7 standard conditions Fig. S3 from Lee et al., 2014
heart autophagosome decreased amount, abnormal zf155Tg + MO1-atg7 standard conditions Fig. 3,  Fig. S5 from Lee et al., 2014
heart looping process quality, abnormal zf155Tg + MO1-atg7 standard conditions Fig. 3 from Lee et al., 2014
pericardium edematous, abnormal zf155Tg + MO1-atg7 standard conditions Fig. 3 from Lee et al., 2014
cardiac ventricle orientation atrium, abnormal zf155Tg + MO1-atg7 standard conditions Fig. 3 from Lee et al., 2014
cell autophagosome assembly decreased process quality, abnormal zf155Tg + MO1-atg7 control Fig. 1 from Lee et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.