Morpholino

MO1-hcfc1b

ID

ZDB-MRPHLNO-150309-3

Name

MO1-hcfc1b

Previous Names

None

Target

Sequence

5' - ACCGAAGTGCCTGAAGAAGCCATGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO. Authors were contacted and provided this corrected sequence.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hcfc1b

No data available

Phenotype

Phenotype resulting from MO1-hcfc1b

Phenotype	Fish	Figures
ceratobranchial cartilage absent, abnormal	vu234Tg + MO1-hcfc1b + MO4-tp53	Fig. 2 , Fig. 4 , Fig. 7 , Fig. 9 from Quintana et al., 2014
ceratohyal cartilage inverted, abnormal	WT + MO1-hcfc1b + MO4-tp53	Fig. 2 from Quintana et al., 2014
ceratohyal cartilage malformed, abnormal	WT + MO1-hcfc1b + MO4-tp53	Fig. 2 , Fig. 7 , Fig. 9 from Quintana et al., 2014
cranial neural crest cell cell population proliferation decreased process quality, abnormal	ba2Tg + MO1-hcfc1b + MO4-tp53	Fig. 5 from Quintana et al., 2014
Meckel's cartilage malformed, abnormal	WT + MO1-hcfc1b + MO4-tp53	Fig. 2 , Fig. 7 , Fig. 9 from Quintana et al., 2014
Meckel's cartilage shortened, abnormal	WT + MO1-hcfc1b + MO4-tp53	Fig. 2 from Quintana et al., 2014
neuroblast differentiation disrupted, abnormal	WT + MO1-hcfc1b	Fig. 4 from Quintana et al., 2017
neuronal stem cell cell population proliferation disrupted, abnormal	WT + MO1-hcfc1b	Fig. 5 from Quintana et al., 2017
splanchnocranium malformed, abnormal	WT + MO1-hcfc1b + MO4-tp53	Fig. 7 , Fig. 9 from Quintana et al., 2014

Phenotype of all Fish created by or utilizing MO1-hcfc1b

Phenotype	Fish	Conditions	Figures
neuroblast differentiation disrupted, abnormal	WT + MO1-hcfc1b	standard conditions	Fig. 4 from Quintana et al., 2017
neuronal stem cell cell population proliferation disrupted, abnormal	WT + MO1-hcfc1b	standard conditions	Fig. 5 from Quintana et al., 2017
Meckel's cartilage malformed, abnormal	WT + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 2 , Fig. 7 , Fig. 9 from Quintana et al., 2014
Meckel's cartilage shortened, abnormal	WT + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 2 from Quintana et al., 2014
ceratohyal cartilage malformed, abnormal	WT + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 2 , Fig. 7 , Fig. 9 from Quintana et al., 2014
splanchnocranium malformed, abnormal	WT + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 7 , Fig. 9 from Quintana et al., 2014
ceratohyal cartilage inverted, abnormal	WT + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 2 from Quintana et al., 2014
ceratobranchial cartilage absent, abnormal	WT + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 2 , Fig. 4 , Fig. 7 , Fig. 9 from Quintana et al., 2014
cranial neural crest cell cell population proliferation decreased process quality, abnormal	ba2Tg + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 5 from Quintana et al., 2014
ceratobranchial cartilage absent, abnormal	vu234Tg + MO1-hcfc1b + MO4-tp53	standard conditions	Fig. 4 from Quintana et al., 2014

Citations