Morpholino

MO1-pcdh15a

ID
ZDB-MRPHLNO-150211-6
Name
MO1-pcdh15a
Previous Names
None
Target
Sequence
5' - CCTCCGCATCTTCACTTAATGCCTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pcdh15a
Phenotype
Phenotype resulting from MO1-pcdh15a
Phenotype Fish Figures
neuromast hair cell decreased functionality, abnormal AB + MO1-pcdh15a Fig. S3 from Ogun et al., 2014
neuromast hair cell cilium assembly decreased process quality, abnormal WT + MO1-pcdh15a Fig. 1 with imageFig. 4 with image from Goodman et al., 2017
neuromast hair cell endocytosis decreased process quality, abnormal WT + MO1-pcdh15a Fig. 6 with image from Goodman et al., 2017
neuromast hair cell intraciliary transport decreased process quality, abnormal WT + MO1-pcdh15a Fig. 7 with image from Goodman et al., 2017
neuromast hair cell kinociliary basal body ab1-cetn labeling spatial pattern, abnormal WT + MO1-pcdh15a Fig. 7 with image from Goodman et al., 2017
neuromast hair cell kinocilium pcdh15a expression absent, abnormal WT + MO1-pcdh15a Fig. 4 with image from Goodman et al., 2017
neuromast hair cell kinocilium itga8 expression absent, abnormal WT + MO1-pcdh15a Fig. 4 with image from Goodman et al., 2017
neuromast hair cell kinocilium ab1-cetn labeling absent, abnormal WT + MO1-pcdh15a Fig. 7 with image from Goodman et al., 2017
neuromast hair cell kinocilium Ab1-rab8a labeling decreased amount, abnormal WT + MO1-pcdh15a Fig. 7 with image from Goodman et al., 2017
neuromast hair cell kinocilium decreased length, abnormal WT + MO1-pcdh15a Fig. 1 with image from Goodman et al., 2017
neuromast hair cell morphogenesis decreased process quality, abnormal WT + MO1-pcdh15a Fig. 1 with image from Goodman et al., 2017
whole organism pcdh15a expression decreased amount, abnormal WT + MO1-pcdh15a Fig. 4 with image from Goodman et al., 2017
whole organism itga8 expression decreased amount, abnormal WT + MO1-pcdh15a Fig. 4 with image from Goodman et al., 2017
Phenotype of all Fish created by or utilizing MO1-pcdh15a
Phenotype Fish Conditions Figures
neuromast hair cell decreased functionality, abnormal AB + MO1-pcdh15a standard conditions Fig. S3 from Ogun et al., 2014
neuromast hair cell kinociliary basal body ab1-cetn labeling spatial pattern, abnormal WT + MO1-pcdh15a standard conditions Fig. 7 with image from Goodman et al., 2017
whole organism pcdh15a expression decreased amount, abnormal WT + MO1-pcdh15a standard conditions Fig. 4 with image from Goodman et al., 2017
neuromast hair cell kinocilium itga8 expression absent, abnormal WT + MO1-pcdh15a standard conditions Fig. 4 with image from Goodman et al., 2017
neuromast hair cell kinocilium pcdh15a expression absent, abnormal WT + MO1-pcdh15a standard conditions Fig. 4 with image from Goodman et al., 2017
neuromast hair cell endocytosis decreased process quality, abnormal WT + MO1-pcdh15a standard conditions Fig. 6 with image from Goodman et al., 2017
whole organism itga8 expression decreased amount, abnormal WT + MO1-pcdh15a standard conditions Fig. 4 with image from Goodman et al., 2017
neuromast hair cell kinocilium decreased length, abnormal WT + MO1-pcdh15a standard conditions Fig. 1 with image from Goodman et al., 2017
neuromast hair cell kinocilium ab1-cetn labeling absent, abnormal WT + MO1-pcdh15a standard conditions Fig. 7 with image from Goodman et al., 2017
neuromast hair cell intraciliary transport decreased process quality, abnormal WT + MO1-pcdh15a standard conditions Fig. 7 with image from Goodman et al., 2017
neuromast hair cell cilium assembly decreased process quality, abnormal WT + MO1-pcdh15a standard conditions Fig. 1 with imageFig. 4 with image from Goodman et al., 2017
neuromast hair cell kinocilium Ab1-rab8a labeling decreased amount, abnormal WT + MO1-pcdh15a standard conditions Fig. 7 with image from Goodman et al., 2017
neuromast hair cell morphogenesis decreased process quality, abnormal WT + MO1-pcdh15a standard conditions Fig. 1 with image from Goodman et al., 2017
Citations