Morpholino

MO1-dmxl2

ID
ZDB-MRPHLNO-150113-6
Name
MO1-dmxl2
Previous Names
  • rbc3a-MO (1)
Target
Sequence
5' - CTTGTTTCCCTTCTCCAATTTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocker; targets the 5' UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dmxl2
No data available
Phenotype
Phenotype resulting from MO1-dmxl2
Phenotype Fish Figures
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. 5 with image from Tuttle et al., 2014
melanoblast neural crest cell aggregated, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. 2 with image from Tuttle et al., 2014
melanocyte decreased amount, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. S1 with image from Tuttle et al., 2014
midbrain hindbrain boundary morphology, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. 2 with image from Tuttle et al., 2014
neural crest cell aggregated, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell mislocalised, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 2 with image,  Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell early endosome aggregated, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 3 with image from Tuttle et al., 2014
neural crest cell early endosome increased amount, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 3 with image,  Fig. S6 with image from Tuttle et al., 2014
neural crest cell early endosome increased size, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 3 with image,  Fig. S6 with image from Tuttle et al., 2014
neural crest cell endocytosis process quality, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 3 with image from Tuttle et al., 2014
neural crest cell endosome immature, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 3 with image from Tuttle et al., 2014
neural crest cell late endosome decreased amount, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 3 with image from Tuttle et al., 2014
neural crest cell late endosome decreased size, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 3 with image from Tuttle et al., 2014
neural crest cell migration decreased rate, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. 2 with image,  Fig. S5 with image from Tuttle et al., 2014
neural crest cell migration disrupted, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 2 with image,  Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell migration process quality, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 Fig. 2 with image from Tuttle et al., 2014
pericardium edematous, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. S1 with image from Tuttle et al., 2014
post-vent region curved, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. S1 with image from Tuttle et al., 2014
post-vent region decreased length, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. 2 with image,  Fig. S1 with image from Tuttle et al., 2014
post-vent region kinked, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. 2 with image from Tuttle et al., 2014
xanthoblast neural crest cell aggregated, abnormal WT + MO1-dmxl2 + MO1-tp53 Fig. 2 with image from Tuttle et al., 2014
Phenotype of all Fish created by or utilizing MO1-dmxl2
Phenotype Fish Conditions Figures
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 5 with image from Tuttle et al., 2014
neural crest cell migration disrupted, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
melanoblast neural crest cell aggregated, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
neural crest cell migration decreased rate, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S5 with image from Tuttle et al., 2014
midbrain hindbrain boundary morphology, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
post-vent region decreased length, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image,  Fig. S1 with image from Tuttle et al., 2014
post-vent region curved, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S1 with image from Tuttle et al., 2014
neural crest cell mislocalised, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
melanocyte decreased amount, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S1 with image from Tuttle et al., 2014
xanthoblast neural crest cell aggregated, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
post-vent region kinked, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
pericardium edematous, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S1 with image from Tuttle et al., 2014
neural crest cell migration decreased rate, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
neural crest cell early endosome aggregated, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell aggregated, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell late endosome decreased size, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell early endosome increased size, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image,  Fig. S6 with image from Tuttle et al., 2014
neural crest cell endosome immature, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell mislocalised, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell endocytosis process quality, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell migration process quality, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
neural crest cell late endosome decreased amount, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell early endosome increased amount, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image,  Fig. S6 with image from Tuttle et al., 2014
neural crest cell migration disrupted, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image,  Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.