Morpholino

MO2-aldh7a1

ID

ZDB-MRPHLNO-141014-5

Name

MO2-aldh7a1

Previous Names

None

Target

aldh7a1 (1)

Sequence

5' - TCGGACACTCGGCAACAGTTTATGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-aldh7a1

Expressed Gene	Anatomy	Figures
pax2a	optic fissure	Fig. 4 from Babcock et al., 2014
vax2	optic fissure	Fig. 4 from Babcock et al., 2014
znf703	(not) optic fissure (not) periocular mesenchyme	Fig. 4 from Babcock et al., 2014

Phenotype

Phenotype resulting from MO2-aldh7a1

Phenotype	Fish	Figures
cranial cartilage morphology, abnormal	AB/TL + MO2-aldh7a1	Fig. 3 from Babcock et al., 2014
cranial nerve II hypoplastic, abnormal	AB/TL + MO2-aldh7a1	Fig. 2 from Babcock et al., 2014
eye decreased size, abnormal	AB/TL + MO2-aldh7a1	Fig. 2 from Babcock et al., 2014
eye morphology, abnormal	AB/TL + MO2-aldh7a1	Fig. S3 from Babcock et al., 2014
eye perforate, abnormal	AB/TL + MO2-aldh7a1	Fig. 2 from Babcock et al., 2014
optic fissure anatomical margin unfused from optic fissure anatomical margin, abnormal	AB/TL + MO2-aldh7a1	Fig. 2 , Fig. S3 from Babcock et al., 2014
pectoral fin shortened, abnormal	AB/TL + MO2-aldh7a1	Fig. 3 from Babcock et al., 2014
pharyngeal arch cartilage morphology, abnormal	AB/TL + MO2-aldh7a1	Fig. 3 from Babcock et al., 2014
post-vent region bent, abnormal	AB/TL + MO2-aldh7a1	Fig. S3 from Babcock et al., 2014
retina cell population proliferation disrupted, abnormal	AB/TL + MO2-aldh7a1	Fig. 5 from Babcock et al., 2014
whole organism deformed, abnormal	WT + MO2-aldh7a1	Fig. S3 from Pena et al., 2017

Phenotype of all Fish created by or utilizing MO2-aldh7a1

Phenotype	Fish	Conditions	Figures
post-vent region bent, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. S3 from Babcock et al., 2014
cranial cartilage morphology, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 3 from Babcock et al., 2014
eye morphology, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. S3 from Babcock et al., 2014
pharyngeal arch cartilage morphology, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 3 from Babcock et al., 2014
eye decreased size, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 2 from Babcock et al., 2014
retina cell population proliferation disrupted, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 5 from Babcock et al., 2014
cranial nerve II hypoplastic, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 2 from Babcock et al., 2014
eye perforate, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 2 from Babcock et al., 2014
optic fissure anatomical margin unfused from optic fissure anatomical margin, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 2 , Fig. S3 from Babcock et al., 2014
pectoral fin shortened, abnormal	AB/TL + MO2-aldh7a1	standard conditions	Fig. 3 from Babcock et al., 2014
eye perforate, abnormal	AB/TL + MO2-aldh7a1 + MO3-aldh7a1	standard conditions	Fig. S3 from Babcock et al., 2014
optic fissure anatomical margin unfused from optic fissure anatomical margin, abnormal	AB/TL + MO2-aldh7a1 + MO3-aldh7a1	standard conditions	Fig. S3 from Babcock et al., 2014
whole organism deformed, abnormal	WT + MO2-aldh7a1	standard conditions	Fig. S3 from Pena et al., 2017

Citations