Morpholino

MO2-bbs5

ID
ZDB-MRPHLNO-140902-1
Name
MO2-bbs5
Previous Names
  • ATG MO (1)
Target
Sequence
5' - GATCACTGTCTGCGTATATTGTCGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bbs5
No data available
Phenotype
Phenotype resulting from MO2-bbs5
Phenotype Fish Figures
caudal fin curved, abnormal WT + MO2-bbs5 Fig. 2 with image from Al-Hamed et al., 2014
cloaca cystic, abnormal zf106Tg + MO2-bbs5 Fig. 5 with image from Al-Hamed et al., 2014
eye decreased size, abnormal WT + MO2-bbs5 Fig. 2 with image,  Fig. 3 with image from Al-Hamed et al., 2014
heart edematous, abnormal WT + MO2-bbs5 Fig. 2 with image from Al-Hamed et al., 2014
heart looping process quality, abnormal twu34Tg + MO2-bbs5 Fig. 4 with image from Al-Hamed et al., 2014
lens detached from retina, abnormal WT + MO2-bbs5 Fig. 3 with image from Al-Hamed et al., 2014
pericardium edematous, abnormal WT + MO2-bbs5 Fig. 2 with image from Al-Hamed et al., 2014
pronephric duct cystic, abnormal zf106Tg + MO2-bbs5 Fig. 5 with image from Al-Hamed et al., 2014
pronephric duct dilated, abnormal zf106Tg + MO2-bbs5 Fig. 5 with image from Al-Hamed et al., 2014
pronephric duct ciliated cell irregular density, abnormal zf106Tg + MO2-bbs5 Fig. 5 with image from Al-Hamed et al., 2014
renal system process process quality, abnormal zf106Tg + MO2-bbs5 Fig. 5 with image from Al-Hamed et al., 2014
retinal neural layer malformed, abnormal WT + MO2-bbs5 Fig. 3 with image from Al-Hamed et al., 2014
retinal outer nuclear layer absent, abnormal WT + MO2-bbs5 Fig. 3 with image from Al-Hamed et al., 2014
Phenotype of all Fish created by or utilizing MO2-bbs5
Phenotype Fish Conditions Figures
retinal outer nuclear layer absent, abnormal WT + MO2-bbs5 standard conditions Fig. 3 with image from Al-Hamed et al., 2014
eye decreased size, abnormal WT + MO2-bbs5 standard conditions Fig. 2 with image,  Fig. 3 with image from Al-Hamed et al., 2014
retinal neural layer malformed, abnormal WT + MO2-bbs5 standard conditions Fig. 3 with image from Al-Hamed et al., 2014
pericardium edematous, abnormal WT + MO2-bbs5 standard conditions Fig. 2 with image from Al-Hamed et al., 2014
lens detached from retina, abnormal WT + MO2-bbs5 standard conditions Fig. 3 with image from Al-Hamed et al., 2014
heart edematous, abnormal WT + MO2-bbs5 standard conditions Fig. 2 with image from Al-Hamed et al., 2014
caudal fin curved, abnormal WT + MO2-bbs5 standard conditions Fig. 2 with image from Al-Hamed et al., 2014
heart looping process quality, abnormal twu34Tg + MO2-bbs5 standard conditions Fig. 4 with image from Al-Hamed et al., 2014
pronephric duct ciliated cell irregular density, abnormal zf106Tg + MO2-bbs5 standard conditions Fig. 5 with image from Al-Hamed et al., 2014
pronephric duct dilated, abnormal zf106Tg + MO2-bbs5 standard conditions Fig. 5 with image from Al-Hamed et al., 2014
renal system process process quality, abnormal zf106Tg + MO2-bbs5 standard conditions Fig. 5 with image from Al-Hamed et al., 2014
cloaca cystic, abnormal zf106Tg + MO2-bbs5 standard conditions Fig. 5 with image from Al-Hamed et al., 2014
pronephric duct cystic, abnormal zf106Tg + MO2-bbs5 standard conditions Fig. 5 with image from Al-Hamed et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.