Morpholino

MO3-crip2

ID

ZDB-MRPHLNO-140821-6

Name

MO3-crip2

Previous Names

Target

Sequence

5' - TCTCTGTTTTACTCACCTCGGCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-crip2

Expressed Gene	Anatomy	Figures
bmp4	atrioventricular canal myocardium	Fig. 3 from Kim et al., 2014
cdh5	endocardium	Fig. 3 from Kim et al., 2014
crip2	head heart tube post-vent region somite trunk	Fig. 2 from Kim et al., 2014
has2	atrioventricular canal	Fig. 4 from Kim et al., 2014
myh7	ventricular myocardium	Fig. 3 from Kim et al., 2014
myl7	atrial myocardium ventricular myocardium	Fig. 3 from Kim et al., 2014
notch1b	atrioventricular canal endocardium	Fig. 3 from Kim et al., 2014
tbx2b	atrioventricular canal myocardium	Fig. 3 from Kim et al., 2014
vcana	atrioventricular canal	Fig. 4 from Kim et al., 2014

Phenotype

Phenotype resulting from MO3-crip2

Phenotype	Fish	Figures
atrioventricular canal development disrupted, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014
atrioventricular ring aplastic, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014
heart morphology, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014
heart looping disrupted, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014
pericardium edematous, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014
post-vent region decreased length, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014
trunk curved dorsal, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014
trunk decreased length, abnormal	twu34Tg + MO3-crip2	Fig. 2 from Kim et al., 2014

Phenotype of all Fish created by or utilizing MO3-crip2

Phenotype	Fish	Conditions	Figures
trunk decreased length, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014
pericardium edematous, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014
trunk curved dorsal, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014
atrioventricular ring aplastic, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014
heart morphology, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014
heart looping disrupted, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014
post-vent region decreased length, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014
atrioventricular canal development disrupted, abnormal	twu34Tg + MO3-crip2	standard conditions	Fig. 2 from Kim et al., 2014

Citations