Morpholino

MO2-ephb4a

ID
ZDB-MRPHLNO-140709-1
Name
MO2-ephb4a
Previous Names
  • AUG (1)
Target
Sequence
5' - GCGGAATCACGAGTGTTTTACTTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ephb4a
No data available
Phenotype
Phenotype resulting from MO2-ephb4a
Phenotype of all Fish created by or utilizing MO2-ephb4a
Phenotype Fish Conditions Figures
caudal vein plexus morphology, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
post-vent vasculature increased amount, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
intersegmental vein increased amount, abnormal y1Tg + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
intersegmental artery decreased amount, abnormal y1Tg + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
intersegmental vessel increased branchiness, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
intersegmental vessel branchiness, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
post-vent vasculature fused with post-vent vasculature, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
caudal vein plexus increased size, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg + MO1-rasa1a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg + MO1-rasa1a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg + MO1-rasa1a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal sd2Tg; y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. S6 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
Citations