Morpholino

MO1-ptpn6

ID
ZDB-MRPHLNO-140506-1
Name
MO1-ptpn6
Previous Names
None
Target
Sequence
5' - ACTCATTCCTTACCCGATGCGGAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptpn6
Expressed Gene Anatomy Figures
mfap4.1 Fig. 2 from Kanwal et al., 2013
mpx Fig. 2 from Kanwal et al., 2013
Phenotype
Phenotype resulting from MO1-ptpn6
Phenotype Fish Figures
apoptotic process increased process quality, abnormal WT + MO1-ptpn6 Fig. 3 from Kanwal et al., 2013
blood island lacks all parts of type leukocyte, abnormal WT + MO1-ptpn6 Fig. 3 from Kanwal et al., 2013
brain mitotic cell cycle increased process quality, abnormal WT + MO1-ptpn6 Fig. 3 from Kanwal et al., 2013
extension edematous, abnormal WT + MO1-ptpn6 Fig. 1 from Kanwal et al., 2013
eye damaged, abnormal WT + MO1-ptpn6 Fig. 1 from Kanwal et al., 2013
eye decreased size, abnormal WT + MO1-ptpn6 Fig. 1 from Kanwal et al., 2013
head decreased size, abnormal WT + MO1-ptpn6 Fig. 1 from Kanwal et al., 2013
heart edematous, abnormal WT + MO1-ptpn6 Fig. S1 from Marín-Juez et al., 2014
Fig. 1 from Kanwal et al., 2013
inflammatory response increased process quality, abnormal WT + MO1-ptpn6 Fig. 3 from Kanwal et al., 2013
integument damaged, abnormal WT + MO1-ptpn6 Fig. 1 from Kanwal et al., 2013
leukocyte accumulation heart anatomical region, abnormal WT + MO1-ptpn6 Fig. 3,  Fig. 4 from Kanwal et al., 2013
retina mitotic cell cycle increased process quality, abnormal WT + MO1-ptpn6 Fig. 3 from Kanwal et al., 2013
yolk syncytial layer edematous, abnormal WT + MO1-ptpn6 Fig. 1 from Kanwal et al., 2013
Phenotype of all Fish created by or utilizing MO1-ptpn6
Phenotype Fish Conditions Figures
heart edematous, abnormal AB/TL + MO1-ptpn6 standard conditions Fig. S1 from Marín-Juez et al., 2014
inflammatory response increased process quality, abnormal WT + MO1-ptpn6 standard conditions Fig. 3 from Kanwal et al., 2013
whole organism decreased life span, abnormal WT + MO1-ptpn6 bacterial treatment Fig. 5 from Kanwal et al., 2013
eye decreased size, abnormal WT + MO1-ptpn6 standard conditions Fig. 1 from Kanwal et al., 2013
integument damaged, abnormal WT + MO1-ptpn6 standard conditions Fig. 1 from Kanwal et al., 2013
retina mitotic cell cycle increased process quality, abnormal WT + MO1-ptpn6 standard conditions Fig. 3 from Kanwal et al., 2013
apoptotic process increased process quality, abnormal WT + MO1-ptpn6 standard conditions Fig. 3 from Kanwal et al., 2013
eye damaged, abnormal WT + MO1-ptpn6 standard conditions Fig. 1 from Kanwal et al., 2013
brain mitotic cell cycle increased process quality, abnormal WT + MO1-ptpn6 standard conditions Fig. 3 from Kanwal et al., 2013
heart edematous, abnormal WT + MO1-ptpn6 standard conditions Fig. 1 from Kanwal et al., 2013
leukocyte accumulation heart anatomical region, abnormal WT + MO1-ptpn6 standard conditions Fig. 3 from Kanwal et al., 2013
blood island lacks all parts of type leukocyte, abnormal WT + MO1-ptpn6 standard conditions Fig. 3 from Kanwal et al., 2013
head decreased size, abnormal WT + MO1-ptpn6 standard conditions Fig. 1 from Kanwal et al., 2013
innate immune response decreased process quality, abnormal WT + MO1-ptpn6 bacterial treatment Fig. 5 from Kanwal et al., 2013
yolk syncytial layer edematous, abnormal WT + MO1-ptpn6 standard conditions Fig. 1 from Kanwal et al., 2013
extension edematous, abnormal WT + MO1-ptpn6 standard conditions Fig. 1 from Kanwal et al., 2013
innate immune response process quality, abnormal WT + MO1-ptpn6 bacterial treatment Fig. 5 from Kanwal et al., 2013
leukocyte accumulation heart anatomical region, abnormal i114Tg + MO1-ptpn6 chemical treatment: pharmaceutical Fig. 4 from Kanwal et al., 2013
inflammatory response increased process quality, abnormal i114Tg + MO1-ptpn6 chemical treatment: pharmaceutical Fig. 4 from Kanwal et al., 2013
leukocyte accumulation heart anatomical region, abnormal i114Tg + MO1-ptpn6 standard conditions Fig. 4 from Kanwal et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.