Morpholino

MO4-hspb7

ID
ZDB-MRPHLNO-140128-6
Name
MO4-hspb7
Previous Names
  • intron1/exon2 boundary (1)
Target
Sequence
5' - GCCTGTTCTGTCTGATGAAAAACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-hspb7
No data available
Phenotype
Phenotype resulting from MO4-hspb7
Phenotype of all Fish created by or utilizing MO4-hspb7
Phenotype Fish Conditions Figures
Kupffer's vesicle motile cilium lacks parts or has fewer parts of type Kupffer's vesicle axonemal central pair, abnormal WT + MO3-hspb7 + MO4-hspb7 standard conditions Fig. 7 with image from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal WT + MO3-hspb7 + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
heart rudiment split bilaterally, abnormal WT + MO3-hspb7 + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
heart rudiment displaced to whole organism axis, abnormal WT + MO3-hspb7 + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
heart rudiment malformed, abnormal WT + MO3-hspb7 + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
heart jogging process quality, abnormal WT + MO3-hspb7 + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
Kupffer's vesicle motile cilium malformed, abnormal WT + MO3-hspb7 + MO4-hspb7 standard conditions Fig. 7 with image from Lahvic et al., 2013
caudal fin truncated, abnormal WT + MO4-hspb7 standard conditions Fig. S3 with image from Musso et al., 2014
heart rudiment displaced to whole organism axis, abnormal WT + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
heart jogging process quality, abnormal WT + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal WT + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
heart rudiment malformed, abnormal WT + MO4-hspb7 standard conditions Fig. 2 with image from Lahvic et al., 2013
Kupffer's vesicle motile cilium immobile, abnormal WT + MO4-hspb7 standard conditions Fig. 7 with image from Lahvic et al., 2013
Kupffer's vesicle lacks parts or has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO4-hspb7 standard conditions Fig. 7 with image from Lahvic et al., 2013
heart contraction process quality, abnormal WT + MO4-hspb7 standard conditions Fig. S3 with image from Musso et al., 2014
Kupffer's vesicle cilium movement process quality, abnormal WT + MO4-hspb7 standard conditions Fig. 7 with image from Lahvic et al., 2013
Citations