Morpholino

MO1-fga

ID

ZDB-MRPHLNO-140115-3

Name

MO1-fga

Previous Names

exon 1 (1)

Target

fga (1)

Sequence

5' - GCATTATATCACTCACCAATGCAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fga

No data available

Phenotype

Phenotype resulting from MO1-fga

Phenotype	Fish	Figures
posterior caudal vein blood coagulation, fibrin clot formation disrupted, abnormal	sd2Tg + MO1-fga (TU)	Fig. 4 from Freire et al., 2020
posterior caudal vein platelet aggregation disrupted, abnormal	sd2Tg + MO1-fga (TU)	Fig. 4 from Freire et al., 2020

Phenotype of all Fish created by or utilizing MO1-fga

Phenotype	Fish	Conditions	Figures
posterior caudal vein platelet aggregation decreased process quality, abnormal	TU + MO1-fga	light damage: posterior caudal vein	Figure 7 from Fish et al., 2021
posterior caudal vein blood coagulation, fibrin clot formation decreased process quality, abnormal	TU + MO1-fga	light damage: posterior caudal vein	Figure 7 from Fish et al., 2021
posterior caudal vein blood coagulation, fibrin clot formation disrupted, abnormal	TU + MO1-fga	light damage: posterior caudal vein	Figure 7 from Fish et al., 2021
posterior caudal vein platelet aggregation disrupted, abnormal	TU + MO1-fga	light damage: posterior caudal vein	Figure 7 from Fish et al., 2021
posterior caudal vein platelet aggregation disrupted, abnormal	sd2Tg + MO1-fga (TU)	control	Fig. 4 from Freire et al., 2020
posterior caudal vein blood coagulation, fibrin clot formation disrupted, abnormal	sd2Tg + MO1-fga (TU)	control	Fig. 4 from Freire et al., 2020
orbital region blood vessel hemorrhagic, abnormal	WT + MO1-fga + MO1-fgb + MO1-fgg	standard conditions	Fig. 4 from Vo et al., 2013
cephalic musculature blood vessel hemorrhagic, abnormal	WT + MO1-fga + MO1-fgb + MO1-fgg	standard conditions	Fig. 4 from Vo et al., 2013
trunk musculature trunk vasculature hemorrhagic, abnormal	WT + MO1-fga + MO1-fgb + MO1-fgg	standard conditions	Fig. 4 from Vo et al., 2013
cranial vasculature hemorrhagic, abnormal	WT + MO1-fga + MO1-fgb + MO1-fgg	standard conditions	Fig. 3 from Vo et al., 2013
whole organism blood vasculature hemorrhagic, abnormal	WT + MO1-fga + MO1-fgb + MO1-fgg	standard conditions	Fig. 3 from Vo et al., 2013
cranial vasculature hemorrhagic, abnormal	sd2Tg + MO1-fga + MO1-fgb + MO1-fgg	standard conditions	Fig. 3 from Vo et al., 2013
whole organism blood vasculature hemorrhagic, abnormal	sd2Tg + MO1-fga + MO1-fgb + MO1-fgg	standard conditions	Fig. 3 from Vo et al., 2013

Citations